Go Back   This Blue Marble, a Global Current Events Discussion Forum > Health and Medicine > Flu Clinic

Flu Clinic A special wing of TBM's Health and Medicine forum set aside for discussing all issues related to influenza, pH1N1, H5N1 or seasonal. Please use the subrooms as appropriate.

Reply
 
Thread Tools Search this Thread Display Modes
Old 04-25-2015, 07:41 PM   #1
NowVoyager
Senior Level 6
 
NowVoyager's Avatar
 
Join Date: Oct 2009
Location: East of paradise and west of tomorrow
Posts: 8,759
Thanks: 20,934
Thanked 7,827 Times in 3,312 Posts
Default New avian flu viruses send U.S. scientists scrambling

If this is a dupe, please delete -- TIA!



New avian flu viruses send U.S. scientists scrambling

Three highly pathogenic avian flu viruses that have infected poultry and wild birds in the U.S. Midwest appear unlikely to present a significant risk to humans. But the presence of the viruses in North America has scientists scrambling to understand their potential long-term threat.

One of the viruses, H5N2, has already led to the slaughter of millions of turkeys and chickens, as commercial farms try to control the spread of the virus.

No humans have yet become infected, but scientists say it is possible that someone in direct contact with sick birds might catch the virus, though it is extremely unlikely that an infected human could pass the disease on to another human.

"Most of the time, these viruses don't have human disease potential, but obviously you need to be very careful," said Dr. Stephen Morse, an expert in emerging infections at Columbia University. "Nowadays, you can't say anything about flu with certainty."

Avian flu, which infects poultry, is caused by an influenza A type virus and is often spread by free-flying waterfowl, such as ducks, geese and shorebirds.

The viruses are classified by two types of proteins. Hemagglutinin or "H" proteins, of which there are 16, and neuraminidase or "N" proteins, of which there are 9. Avian flu viruses are also classified as low pathogenicity or high pathogenicity based on their ability to infect and kill poultry.

The highly pathogenic avian flu viruses currently killing U.S. poultry first originated as a single H5N8 virus in Asia, and quickly spread among wild birds along migratory pathways in the Pacific flyway.

Once the virus reached North America, it mutated, mixing with North American avian influenza strains to create the new viruses now being seen. The H parts, which are highly pathogenic in poultry, originated in Asia, and the N parts come from North American, low pathogenic, avian flu viruses, said Dr. Rubin Donis, an associate director for policy and preparedness in the Centers for Disease Control and Prevention's influenza division.

The U.S. Department of Agriculture is still seeing the original H5N8 virus, but it has also identified two strains of mixed-origin viruses, both of them highly pathogenic. One is the deadly H5N2 virus. The other is an entirely new H5N1 virus that has so far been found in only a handful of the recent cases.

Because much is still unknown about these new viruses, the USDA and the CDC are conducting detailed analyses that include sequencing the viruses' genomes. A key question they hope to answer is whether the viruses might mutate and become human viruses.

"This is something we need to avoid: it is something that could happen and which we have to look for," said Dr. Jurgen Richt, an expert in avian influenza at Kansas State University.

Richt said scientists also need to find out whether the viruses are mutating when they come from a wild host into domesticated poultry.

Although infections with H5N1 viruses have been rare, past strains have sometimes caused severe disease and death in people who became infected through close contact with infected birds or prolonged contact with infected people. Since flu viruses evolve and often swap genes, the concern is that they could gain the ability to transmit easily among people, which could trigger a global pandemic

Donis said the CDC is currently conducting studies in ferrets, which are used as surrogate models for humans, to see how the viruses behave in mammals and whether they can spread easily to animals in nearby cages.

One good sign already is that the H5N2 virus does not appear to be able to replicate readily at lower temperatures, which is required for transmission from person to person.

Donis said human transmission of flu viruses occurs in the upper respiratory tract, where body temperatures are lower.

"You will not have a pandemic without a virus that replicates well in the upper respiratory tract and is easily transmitted by droplets," Donis said.

The CDC has already studied a lab-developed version of the avian hemagglutinin, the "H" portion of the viruses, to see if it contains receptors that could easily attach to human cells. In these experiments, the "H" has bound strictly to avian receptors, and not human receptors, another good sign that the virus may not be easily transmissible in people.

"So far, what we see is a typical avian virus that is not expected to be transmissible in ferrets," Donis said. Results of the ferret studies should be available in a few weeks.

A SPREADING THREAT

The mere fact that an H5N1 avian influenza virus has arrived in North America, however, represents a significant evolution.

Before 1996, none of the highly pathogenic viruses survived very long in nature. H5N1 viruses had largely been confined to Southeast Asia.

"They always burned out and they were never transmitted long distances repeatedly by wild birds," Donis said.

Things began to change in 2004/2005 when an H5N1 virus began infecting birds in Qinghai Lake, China, and then spread to parts of Europe and Africa.

Scientists in North America began collecting millions of samples looking for the virus in North American birds.

"There wasn't a single H5N1," Donis said, until this past January, when a new, mixed origin H5N1 virus was isolated in a wild duck in the United States.

The question now is what has changed that makes this virus more capable of spreading in both Eastern and Western directions.

The concern is if the virus becomes established in the breeding grounds in Alaska and Northern Canada, there is a potential for these viruses to become an annual burden each time the birds migrate south.
http://news.yahoo.com/avian-flu-viruses-send-u-scientists-scrambling-230603954.html;_ylt=AwrC0COrHzxV_D4AVBrQtDMD;_ylu= X3oDMTByNXM5bzY5BGNvbG8DYmYxBHBvcwMzBHZ0aWQDBHNlYw Nzcg--

__________________
The untold want, by life and land ne’er granted,
Now, Voyager, sail thou forth, to seek and find.

Walt Whitman
NowVoyager is offline   Reply With Quote
The Following 4 Users Say Thank You to NowVoyager For This Useful Post:
andy (04-25-2015), CanadaSue (04-25-2015), lonfa (04-26-2015), Twoolf (04-25-2015)
Old 04-26-2015, 05:25 PM   #2
Auburn Boy
Denizen of the Gold Fields
 
Auburn Boy's Avatar
 
Join Date: Aug 2008
Posts: 8,391
Thanks: 2,250
Thanked 1,082 Times in 642 Posts
It seems odd to me that TBM is not covering this series of outbreaks as we had others in the past..,

__________________
(\__/)
(='.'=) This is Bunny. Copy and paste bunny into your
(")_(") signature to help her gain world domination
Can't leave the Siwwy Wabbit behind!!
Auburn Boy is offline   Reply With Quote
Old 04-26-2015, 06:21 PM   #3
CanadaSue
SuperModerator
 
CanadaSue's Avatar
 
Join Date: Nov 2008
Location: In my gardens or online
Posts: 35,508
Blog Entries: 28
Thanks: 2,486
Thanked 11,046 Times in 5,057 Posts
Flu'd out a bit, maybe.

Sadly, we see so many outbreaks they almost become part of our norm. Ontario has had 3 turkey farms hit with the current flu strains - thankfully, no human illness.

We've done the same thing with Ebola - it's still out there but we're barely talking about it. Personally, I'm doomed out. We had our own personal encounter with ''near doom' this winter & emotionally, have not recovered from that. I'm at the point where I'm looking for good news items, quirky, off the wall - I don't have to go looking for the awful stories - they reach through my TV screen & grab me by the throat.
__________________
Searching for a dream to run after & catch!
CanadaSue is offline   Reply With Quote
The Following User Says Thank You to CanadaSue For This Useful Post:
NowVoyager (04-26-2015)
Old 04-27-2015, 09:47 AM   #4
Auburn Boy
Denizen of the Gold Fields
 
Auburn Boy's Avatar
 
Join Date: Aug 2008
Posts: 8,391
Thanks: 2,250
Thanked 1,082 Times in 642 Posts
No Human illness.

Yet..,

http://news.yahoo.com/increased-huma...050610852.html

Quote:
Hundreds of farm workers exposed to a highly pathogenic strain of bird flu have been offered antiviral medication as a preventative measure in recent days
Quote:
So far, the outbreak has affected more than 7.3 million birds in U.S. commercial flocks. On Friday, an APHIS official told Reuters the department has a pool of $84.2 million in funds available for the outbreak. It is already aware of $60 million in indemnity claims that will be made by poultry farmers seeking compensation for culled flocks.
Tip of the iceberg.
__________________
(\__/)
(='.'=) This is Bunny. Copy and paste bunny into your
(")_(") signature to help her gain world domination
Can't leave the Siwwy Wabbit behind!!
Auburn Boy is offline   Reply With Quote
Old 04-27-2015, 09:58 AM   #5
Exodia
Khan of the Golden Horde
 
Exodia's Avatar
 
Join Date: Aug 2008
Location: Southeast PA
Posts: 11,058
Thanks: 2,486
Thanked 4,551 Times in 2,067 Posts
Quote:
Originally Posted by Auburn Boy View Post
It seems odd to me that TBM is not covering this series of outbreaks as we had others in the past..,

Yes, in the "old days" it would have been

HiPath showing up the in the US would have been a BIG story.

But I think because H5N1 never went full-on human, and H7N9 sort of dropped off the radar, the avian viruses are looked at more with a "keep and eye on it" flavor than anything.
__________________
"Now, mark my words. So long as we are a young and virtuous people, this instrument will bind us together in mutual interests, mutual welfare, and mutual happiness. But when we become old and corrupt, it will bind us no longer" - Alexander Hamilton about the US Constitution.
Exodia is online now   Reply With Quote
Old 05-03-2015, 02:20 AM   #6
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
http://thisbluemarble.com/showthread.php?t=60496
(2014/12/03 , not Jan. as Donis said above)
http://thisbluemarble.com/showthread.php?t=60238
(meanwhile I had posted about the American sequences somewhere)
http://thisbluemarble.com/showthread.php?t=61990


16M killed in Iowa = 25% of all poultry
5M on 72 farms in Minnesota
__________________
a chart says more than 1000 words

Last edited by gsgs; 05-03-2015 at 02:28 AM.
gsgs is offline   Reply With Quote
Old 05-03-2015, 07:58 AM   #7
andy
Senior Level 5
 
andy's Avatar
 
Join Date: Aug 2008
Location: Gainesville, Florida
Posts: 5,438
Thanks: 587
Thanked 1,172 Times in 625 Posts
I have been to poultry farm. They are pretty secure. I STILL think that insects are the means of transporting the virus from outside to the inside of the chicken houses. I can not really see any other entrance.
andy is offline   Reply With Quote
Old 05-11-2015, 07:48 PM   #8
NowVoyager
Senior Level 6
 
NowVoyager's Avatar
 
Join Date: Oct 2009
Location: East of paradise and west of tomorrow
Posts: 8,759
Thanks: 20,934
Thanked 7,827 Times in 3,312 Posts
A source we can link to is reporting a strain of H5N8 in a backyard poultry flock in NE Indiana.

Some of the mixed fowl flock had died -- the rest have been taken away.
__________________
The untold want, by life and land ne’er granted,
Now, Voyager, sail thou forth, to seek and find.

Walt Whitman
NowVoyager is offline   Reply With Quote
Old 05-11-2015, 08:39 PM   #9
Catbird
Chasing my tailfeathers
 
Catbird's Avatar
 
Join Date: Mar 2011
Location: East TN
Posts: 10,802
Thanks: 5,622
Thanked 8,152 Times in 3,348 Posts
This strain of H5N8 was last seen in CA.

The owner had just recently purchased at least some of the affected poultry, but the article doesn't mention the source.


http://www.journalgazette.net/news/l...ley-hobby-farm

Quote:
The first known case of avian influenza in Indiana has been reported in Whitley County.

The U.S. Department of Agriculture confirmed Monday that poultry at a backyard hobby farm near Columbia City has tested positive for the bird flu strain H5N8.

The site had been home to 77 chickens, turkeys, ducks and geese, which were euthanized and sent to laboratories at Purdue University and in Iowa over the weekend.

"The owner of the flock recently purchased the birds, and after a few days some of the birds started getting sick and dying," Denise Derrer, public information officer for the Indiana State Board of Animal Health, said Monday in a telephone interview.

The flock owner contacted the animal health board's office, which sent two veterinarians to the site Friday night to take samples and begin the testing process at Purdue and at a USDA lab in Ames, Iowa.

The hobby farm will be disinfected and under quarantine for 21 days, Derrer said, and neighboring poultry farmers are being contacted by state veterinarians.

"This is a significant finding for the fact that we have not had a highly pathogenic avian influenza in Indiana before," Derrer said.

Indiana is among 14 states, most of them in the upper Midwest and the Pacific Northwest, to report 143 avian flu cases since December. Indiana is the nation's leading producer of ducks and among the top producers of turkeys.

The virus strain found in Whitley County has not been seen since a case was reported in California in February. The H5N8 flu "kills domestic birds pretty quickly," Derrer said, but poses little risk to other species.

"The Centers for Disease Control has said there is a very low risk to humans. ... There has been no history of human infection from these viruses," she said.

"It's also important to note that it is not a food safety risk. Your eggs and poultry are still safe to eat," Derrer said.

She said veterinarians for the State Board of Animal Health have been in contact with nine poultry owners within 6.2 miles of the infected site for flu tests, "trying to make sure that the disease hasn't spread." They owners include a commercial egg operation.

..."It's made a big jump from California to Indiana. How it got here we don't know," Derrer said.
__________________
"I think the most un-American thing you can say is, 'You can't say that.'” Garrison Keillor

"It's not inequality which is the real misfortune, it's dependence." Voltaire
Catbird is offline   Reply With Quote
The Following User Says Thank You to Catbird For This Useful Post:
NowVoyager (05-11-2015)
Old 05-12-2015, 05:17 PM   #10
Catbird
Chasing my tailfeathers
 
Catbird's Avatar
 
Join Date: Mar 2011
Location: East TN
Posts: 10,802
Thanks: 5,622
Thanked 8,152 Times in 3,348 Posts
And now Nebraska.


Bird Flu Now Confirmed in Nebraska
Quote:
The United States Department of Agriculture’s Animal and Plant Health Inspection Service has confirmed the presence of highly pathogenic H5N2 avian influenza in a commercial layer flock in Dixon County, Nebraska in the far northeastern part of the state. The flock of 1.7 million chickens is located within the Central flyway where this strain of avian influenza has previously been identified. CDC considers the risk to people from these HPAI H5 infections in wild birds, backyard flocks and commercial poultry, to be low. No human infections with the virus have been detected at this time.

Samples from the chicken flock, which experienced increased mortality, were tested at the South Dakota State University Animal Disease Research & Diagnostic Laboratory and the APHIS National Veterinary Services Laboratories in Ames, Iowa confirmed the findings. NVSL is the only internationally recognized AI reference laboratory in the United States. APHIS is working closely with the Nebraska Department of Agriculture on a joint incident response. State officials quarantined the premises and birds on the property will be depopulated to prevent the spread of the disease.
I didn't know that the NVSL is the only AI reference lab in the US. Nothing like putting all our eggs in one basket.
__________________
"I think the most un-American thing you can say is, 'You can't say that.'” Garrison Keillor

"It's not inequality which is the real misfortune, it's dependence." Voltaire
Catbird is offline   Reply With Quote
Old 05-19-2015, 10:16 AM   #11
Exodia
Khan of the Golden Horde
 
Exodia's Avatar
 
Join Date: Aug 2008
Location: Southeast PA
Posts: 11,058
Thanks: 2,486
Thanked 4,551 Times in 2,067 Posts
We had to tell the 4H kids last night that we won't be able to show birds at the Grange fair or PA Farm show this year (and probably next year).

Quote:
PA Suspends Poultry Competitions Due To Bird Flu

John Clay 05/11/2015 10:17 PM

HARRISBURG - The Pennsylvania Agriculture Department has suspended all 2015 competitions that involve poultry. That includes chicken competitions at state fairs and the Pennsylvania Farm Show. It's due to concerns over the Avian Flu Virus, or Bird Flu. The latest strain has killed or forced producers to euthanize 15-million birds across the nation. In 2014, the poultry and egg industry lead to $13 billion in total economic activity throughout Pennsylvania.

Here's the release from the PA Ag Dept.

PA Agriculture Department Suspends Avian Competitions, Activities at 2015 State-Approved Agricultural Fairs, 2016 PA Farm Show

Harrisburg - As the threat of highly pathogenic avian influenza, or H5N2, intensifies nationwide, the Pennsylvania Department of Agriculture is continuing efforts to minimize the risk of the disease spreading here, should it be found. As such, acting Agriculture Secretary Russell Redding announced today that the department is suspending all avian competitions at state-approved agricultural fairs in 2015, as well as the 2016 Pennsylvania Farm Show.

snip

"This is not a decision we made lightly, but it is one that we feel is necessary given the threat," Redding said. "Across the country, 145 flocks have tested positive for this disease. This strain has killed or forced producers to euthanize 15 million birds. The effect has been devastating, and we do not want to see the same kind of impact here in Pennsylvania."
http://www.wearecentralpa.com/story/...HESorqUxRpmnrQ
__________________
"Now, mark my words. So long as we are a young and virtuous people, this instrument will bind us together in mutual interests, mutual welfare, and mutual happiness. But when we become old and corrupt, it will bind us no longer" - Alexander Hamilton about the US Constitution.
Exodia is online now   Reply With Quote
Old 05-19-2015, 02:30 PM   #12
Exodia
Khan of the Golden Horde
 
Exodia's Avatar
 
Join Date: Aug 2008
Location: Southeast PA
Posts: 11,058
Thanks: 2,486
Thanked 4,551 Times in 2,067 Posts
Quote:
Bird flu could cost nearly $1 billion in Minnesota and Iowa

May 18, 2015 DAVID PITT

Bird flu could cost nearly $1 billion in the economies of the two states hardest hit, Minnesota and Iowa, agricultural economists said Monday, and the virus is still spreading.

Iowa, the nation’s leading egg producer, has lost about 20 million chickens that lay eggs for food use, more than a third of the total. Minnesota, the top turkey state has lost more than 8 million birds.

So far the U. S. Department of Agriculture has confirmed the bird flu has claimed nearly 37 million birds in 15 states but the number is significantly larger because additional farms in Iowa and Minnesota recently discovered are not yet on the list. The figures include birds killed by the virus as well as those killed to prevent its spread.

On Saturday, Rembrandt Foods announced that chickens at its second farm, an egg facility in Renville, Minnesota, had tested positive for the virus. About 2 million chickens will be euthanized. The company, one of the largest egg producers in the U.S., had to destroy 5.5 million chickens on its Rembrandt, Iowa, farm after the flu turned up there last month.

“Avian Influenza is a challenge to not only the Rembrandt Foods’ business, but also its co-workers, customers, the communities in which it operates, and to the widespread industry as a whole,” Jonathan Spurway, a company spokesman, said in a statement.

Minnesota’s estimated loss of nearly $310 million in poultry production includes sales losses to feed suppliers, trucking companies, and processing plants, said Brigid Tuck, a senior economic impact analyst with the University of Minnesota in Mankato.

The loss in sales of poultry alone is estimated at $114 million. The estimates were based on the bird losses as of last Monday.
http://www.seattletimes.com/business...sota-and-iowa/
__________________
"Now, mark my words. So long as we are a young and virtuous people, this instrument will bind us together in mutual interests, mutual welfare, and mutual happiness. But when we become old and corrupt, it will bind us no longer" - Alexander Hamilton about the US Constitution.
Exodia is online now   Reply With Quote
Old 05-21-2015, 05:16 AM   #13
LvDemWings
Wingy Spud
 
LvDemWings's Avatar
 
Join Date: Aug 2008
Posts: 5,434
Blog Entries: 2
Thanks: 74
Thanked 2,266 Times in 1,025 Posts
New York has done the same. No live birds and accoording to the radio no bird products like crafts containing feathers. I wonder what the county will do with their poultry barn this year.

Quote:
Originally Posted by Exodia View Post
We had to tell the 4H kids last night that we won't be able to show birds at the Grange fair or PA Farm show this year (and probably next year).



http://www.wearecentralpa.com/story/...HESorqUxRpmnrQ
__________________
Federal lands, monuments, and waterways belong to We The People... not we the government.
LvDemWings is offline   Reply With Quote
Old 05-28-2015, 08:18 AM   #14
Exodia
Khan of the Golden Horde
 
Exodia's Avatar
 
Join Date: Aug 2008
Location: Southeast PA
Posts: 11,058
Thanks: 2,486
Thanked 4,551 Times in 2,067 Posts
Wholesale egg prices up 71% nationally.

Quote:
Because of a bird flu outbreak, wholesale prices for eggs have risen to over $2.00 a dozen, up a whopping 71% since late April. Retail prices haven't risen nearly as fast -- up 17% in the past month according to The Guardian...but grocers can only hold off passing on the price increase to consumers for so long.

The avian flu has forced American farmers in 16 states to kill 40 million birds so far, the vast majority of them egg-laying hens. More than 10% of the entire U.S. egg supply has already been affected by the outbreak, according to The Washington Post, with Iowa farms particularly hard hit.

The impact of this bird flu outbreak goes far beyond your breakfast table. The price of liquid, dried and frozen eggs used by food manufacturers has risen nearly 30% in the past month. And a potential shortage of these so-called breaker eggs is forcing corporations like McDonald's, Unilever, Panera and General Mills to scramble to find alternative suppliers and substitute ingredients.

If the bird flu does lead to shortages, expect to pay more for all kinds of egg-rich products like mayonnaise, baked goods and ice cream in the weeks and months ahead. And this Thanksgiving could be more expensive too. Hormel Foods says its Jennie O Turkeys might be in short supply because of the avian flu outbreak, which has forced farmers to euthanize over 3.3 million turkeys in Minnesota, which produces nearly 20% of America's turkey flock.
http://finance.yahoo.com/news/egg-sp...152021643.html
__________________
"Now, mark my words. So long as we are a young and virtuous people, this instrument will bind us together in mutual interests, mutual welfare, and mutual happiness. But when we become old and corrupt, it will bind us no longer" - Alexander Hamilton about the US Constitution.
Exodia is online now   Reply With Quote
Old 05-28-2015, 09:55 AM   #15
flowerchild
Senior Level 1
 
Join Date: Aug 2008
Posts: 1,726
Thanks: 192
Thanked 365 Times in 228 Posts
Just a warning. I know a butcher who works for Kroger. He says the price of their chicken is going up quite a bit, starting next week.
flowerchild is offline   Reply With Quote
Old 05-28-2015, 09:58 AM   #16
Auburn Boy
Denizen of the Gold Fields
 
Auburn Boy's Avatar
 
Join Date: Aug 2008
Posts: 8,391
Thanks: 2,250
Thanked 1,082 Times in 642 Posts
Egg prices up 70% this year.

Turkeys may be a rarity for the Thanksgiving Table.

VACCINE manufacturing may suffer.

Most of the affected flocks in the U.S. are EGG LAYERS. SHortages will force up prices on things like MAYO!!
__________________
(\__/)
(='.'=) This is Bunny. Copy and paste bunny into your
(")_(") signature to help her gain world domination
Can't leave the Siwwy Wabbit behind!!
Auburn Boy is offline   Reply With Quote
Old 07-12-2015, 02:06 PM   #17
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
mutation table of the available American H5Nx (Asian) viruses:
[mutations that occur only once in the table are omitted, as usual]

Code:
                                                              000001112 000000112 0000111111122 00000000000111111111 00000 0001111111 000 000 
                                                              055890390 245569291 5888003344500 00112233469012344556 33679 6670122233 369 567 
                                                              256273345 514944856 1469156822302 22594514620154636495 12846 4751603400 292 251 
                                                              487255555 240149108 0074008623616 02226852940357571901 56742 2282475648 761 705 
-codon-position-----------------------------------------------       1      21  2     2    1  1 212     1  2 2   1 1  2  2   21 1212      221 
---Index------------------------------------------------------AGAGTTGGA AGAGGAGCG GGAGCTTATGGCC TCAGGCCTTAGTCACTCGGC GTATA TGGATTTAGG CTA TAG 
   1 >American Index/h5n2,2014//,USA,H5N8                     ......... ......... ............. .................... ..... .......... ... ...        0      0 ,      0      0       1:>American Index/h5n2,2014//,USA,H5N8                     
   2 >A/guinea fowl/Oregon/41613-1/2014,2014/12/16,USA,H5N8   .....C... --------- .A....C...AT. ......A.......TC.... ----- ---------- T.. ...       89     33 ,      9      9       2:>A/guinea fowl/Oregon/41613-1/2014,2014/12/16,USA,H5N8   
   3 >A/Ck/Oregon/41613-2/2014,2014/12/16,USA,H5N8            .....C... --------- .A....C...AT. ......A.......TC.... ----- ---------- T.. ...       89     33 ,      9      9       3:>A/Ck/Oregon/41613-2/2014,2014/12/16,USA,H5N8            
   4 >A/gyrfalcon/WA/41088-6/2014,2014/12/08,USA,H5N8         ......... --------- .A.........T. ......A.......TC.... ----- ---------- T.. ...       88     30 ,      8      6       4:>A/gyrfalcon/WA/41088-6/2014,2014/12/08,USA,H5N8         
   5 >A/Tk/California/K1500169-1.2/2015,2015/01/21,USA,H5N8   ......... --------- ............. .....T....T........T ----- ---------- ... ...       93     27 ,     13      3       5:>A/Tk/California/K1500169-1.2/2015,2015/01/21,USA,H5N8   
   6 >A/American GWteal/WA/195750/2014,2014/12/29,USA,H5N1    ......... --------- ------------- .....T....T......A.T ----- ---------- ... ---      148     44 ,     11      4       6:>A/American GWteal/WA/195750/2014,2014/12/29,USA,H5N1    
   7 >A/Ck/WA/3490-18/2015,2015/01/29,USA,H5N2                ....C.... ......... ...A....C.... .T..........A....... ..... .......... ... ...       23      5 ,     23      5       7:>A/Ck/WA/3490-18/2015,2015/01/29,USA,H5N2                
   8 >A/Tk/BC/FAV10/2014,2014/12/02,Canada,H5N2               ....C.... ......... ...A....C.... .T..........A....... ..G.. .A........ ... ...       15      7 ,     15      7       8:>A/Tk/BC/FAV10/2014,2014/12/02,Canada,H5N2               
   9 >A/Northern pintail/WA/40964/2014,2014/12/08,USA,H5N2    ....C.... ......... ------------- ............A....... ..... .......... ... ...       44     15 ,      7      2       9:>A/Northern pintail/WA/40964/2014,2014/12/08,USA,H5N2    
  10 >A/Ck/BC/FAV9/2014,2014/12/03,Canada,H5N2                ....C.... ...A..... ...A.C..C.... .T..........AG...... ..... ...T....T. ... ...       19     10 ,     19     10      10:>A/Ck/BC/FAV9/2014,2014/12/03,Canada,H5N2                
  11 >A/Ck/BC/FAV8/2014,2014/12/03,Canada,H5N2                ....C.... ...A..... ...A.C..C.... .T..........AG...... ..... .A.T....T. ... ...       12     11 ,     12     11      11:>A/Ck/BC/FAV8/2014,2014/12/03,Canada,H5N2                
  12 >A/pheasant/WA/3147-2/2015,2015/01/26,USA,H5N2           ....C..A. ......... ..GA....C...T .T..........A....... ..... .......... ... ...       19      8 ,     19      8      12:>A/pheasant/WA/3147-2/2015,2015/01/26,USA,H5N2           
  13 >A/Ck/Oregon/A01819044/2015,2015/02/11,USA,H5N2          ....C..A. ......... ..GA....C...T .T..........A....... ..... .......... ..G C..       19     10 ,     19     10      13:>A/Ck/Oregon/A01819044/2015,2015/02/11,USA,H5N2          
  14 >A/domestic duck/WA/61-16/2014,2014/12/30,USA,H5N2       ...AC..A. G...A.... ..GA....C...T .TGA........A...T... ....C .....CC... ..G C.A       22     20 ,     22     20      14:>A/domestic duck/WA/61-16/2014,2014/12/30,USA,H5N2       
  15 >A/Ck/WA/61-9/2014,2014/12/30,USA,H5N2                   ...AC..A. G...A.... ..GA....C...T .TGA........A...T... A...C .....CC... ..G C.A       22     21 ,     22     21      15:>A/Ck/WA/61-9/2014,2014/12/30,USA,H5N2                   
  16 >A/Tk/WA/61-22/2014,2014/12/30,USA,H5N2                  ...AC..A. ......... ..GA....C...T .TG.........A...T... ..... ......C... ..G C..       15     14 ,     15     14      16:>A/Tk/WA/61-22/2014,2014/12/30,USA,H5N2                  
  17 >A/Tk/Arkansas/7791-1/2015,2015/03/08,USA,H5N2           .A..C..AG ......... ..GA...GC...T .T......C...A....... ..... ..A...C... ..G C..       30     16 ,     30     16      17:>A/Tk/Arkansas/7791-1/2015,2015/03/08,USA,H5N2           
  18 >A/Ck/Kansas/8395-3/2015,2015/03/12,USA,H5N2             G...C..AG ......... A.GA...GC...T .T..........A....... ..G.. C.A...C... ..G C..       29     18 ,     29     18      18:>A/Ck/Kansas/8395-3/2015,2015/03/12,USA,H5N2             
  19 >A/Tk/Minnesota/7172-1/2015,2015/02/27,USA,H5N2          G...C..AG ......... A.GA...GC...T .T..........A....... ..G.. C.A...C... ..G C..       26     18 ,     26     18      19:>A/Tk/Minnesota/7172-1/2015,2015/02/27,USA,H5N2          
  20 >A/Tk/Missouri/7458-1/2015,2015/03/06,USA,H5N2           ....C..AG ......... A.GA...GC...T .T..........A....... ..GA. C.A...C... ..G C..       25     18 ,     25     18      20:>A/Tk/Missouri/7458-1/2015,2015/03/06,USA,H5N2           
  21 >A/Tk/Minnesota/9892-2/2015,2015/03/26,USA,H5N2          ..G.C..AG .A..A...T A.GAT...C...T .T......C...A....... A.GA. C.A...C..A ..G CC.       31     26 ,     31     26      21:>A/Tk/Minnesota/9892-2/2015,2015/03/26,USA,H5N2          
  22 >A/Tk/Iowa/11762-1/2015,2015/04/12,USA,H5N2              .AG.C..AG .A..A...T A.GAT..GCA..T .T......C...A....... ..GA. C.A...C..A ..G CC.       32     28 ,     32     28      22:>A/Tk/Iowa/11762-1/2015,2015/04/12,USA,H5N2              
  23 >A/Tk/Minnesota/9845-4/2015,2015/03/25,USA,H5N2          ....C..AG .A..A..T. A.GAT..GC...T .T......C...A....... ..GA. C.A...C..A ..G CC.       28     25 ,     28     25      23:>A/Tk/Minnesota/9845-4/2015,2015/03/25,USA,H5N2          
  24 >A/Ck/Iowa/13542-2/2015,2015/04/25,USA,H5N2              ....C.AAG .AC.AGCT. A.GAT..GCA..T CT.....CCG.AA.....A. .CGA. C.A.C..G.A .CG CC.       38     38 ,     38     38      24:>A/Ck/Iowa/13542-2/2015,2015/04/25,USA,H5N2              
  25 >A/Ck/Iowa/14322-6/2015,2015/05/01,USA,H5N2              ....C.AAG .AC.AGCT. A.GAT..GCA..T CT..A..CCG.AA.....A. .CGA. C.A.C..G.A .CG CC.       43     39 ,     43     39      25:>A/Ck/Iowa/14322-6/2015,2015/05/01,USA,H5N2              
  26 >A/Tk/Iowa/14319-1/2015,2015/05/01,USA,H5N2              ....C.AAG .AC.AGCT. A.GAT..GCA..T CT..A..CCG.AA.....A. .CGA. C.A.C..G.A .CG CC.       40     39 ,     40     39      26:>A/Tk/Iowa/14319-1/2015,2015/05/01,USA,H5N2              
  27 >A/Ck/Iowa/14399-4/2015,2015/04/30,USA,H5N2              ....C.AAG .AC.AGCT. A.GAT..GCA..T CT..A..CCG.AA....AA. .CGA. C.A.C..G.A .CG CC.       47     40 ,     47     40      27:>A/Ck/Iowa/14399-4/2015,2015/04/30,USA,H5N2              
  28 >A/Ck/Iowa/04-20/2015,2015/04/20,USA,H5N2                ....C.AAG .AC.AGCT. A.GAT..GCA..T CT..A..CCG.AA.....A. .CGA. C.A.C..G.A .CG CC.       40     39 ,     40     39      28:>A/Ck/Iowa/04-20/2015,2015/04/20,USA,H5N2                
  29 >A/Ck/Iowa/14589-1/2015,2015/05/04,USA,H5N2              ....C.AAG .AC.AGCT. ------------- CT..A..CCG.AA.....A. .CGA. C.A.C..G.A .CG CC.       69     44 ,     32     31      29:>A/Ck/Iowa/14589-1/2015,2015/05/04,USA,H5N2              
  30 >A/Tk/Iowa/13541-1/2015,2015/04/25,USA,H5N2              ....C.AAG .AC.AGCT. A.GAT..GCA..T CT..A..CCG.AA.....A. .CGA. C.A.C..G.A .CG CC.       42     39 ,     42     39      30:>A/Tk/Iowa/13541-1/2015,2015/04/25,USA,H5N2              
  31 >A/Tk/Iowa/14318-1/2015,2015/04/30,USA,H5N2              ....C.AAG .AC.AGCT. A.GAT..GCA..T CT..A..CCG.AA.....A. .CGA. C.A.C..G.A .CG CC.       41     39 ,     41     39      31:>A/Tk/Iowa/14318-1/2015,2015/04/30,USA,H5N2              
                                                                                                                                              
---Index------------------------------------------------------AGAGTTGGA AGAGGAGCG GGAGCTTATGGCC TCAGGCCTTAGTCACTCGGC GTATA TGGATTTAGG CTA TAG 
-codon-position-----------------------------------------------       1      21  2     2    1  1 212     1  2 2   1 1  2  2   21 1212      221 
                                                              000001112 000000112 0000111111122 00000000000111111111 00000 0001111111 000 000 
                                                              055890390 245569291 5888003344500 00112233469012344556 33679 6670122233 369 567 
                                                              256273345 514944856 1469156822302 22594514620154636495 12846 4751603400 292 251 
                                                              487255555 240149108 0074008623616 02226852940357571901 56742 2282475648 761 705

MN9892 and MN9845 are only one day apart and have similar numbering, so they could
be from the same farm.
But 9845 has C1950T(2) which MN9892 has not and that mutation went then into the Iowa sequences.
This is some (small) evidence for farm-to-farm-transmission

---------edit--------------------
sorry, not the same farm. But I wonder whether they are looking
for such mutations ?!
-------------------------------------
http://www.ncbi.nlm.nih.gov/nuccore/KR233979
Stearns County, Minnesota"
/collection_date="26-Mar-2015"
/collected_by="Dr. Jill Nezworski"
/note="NVSL 15-009892 EP1; Eurasian origin (EA-H5N8 clade
2.3.4.4)-North American reassortant; 18 week old toms"
----------------------------------------------------------------------
http://www.ncbi.nlm.nih.gov/nuccore/KR234035
/host="turkey; commercial; 12 week old tom"
/country="USA: Lac Qui Parle County, Minnesota"
collection_date="25-Mar-2015"
--------------------------------------------------------------------


I count 39 mutations in 6 months for the Iowa-viruses,
which is pretty much. I'd expected ~50 per year for H5N1
in chickens.
__________________
a chart says more than 1000 words

Last edited by gsgs; 07-12-2015 at 02:35 PM.
gsgs is offline   Reply With Quote
Old 07-12-2015, 04:38 PM   #18
oldasrocks
Senior Member
 
Join Date: Sep 2008
Posts: 1,088
Thanks: 37
Thanked 280 Times in 180 Posts
That settles it. I'm moving my hens into the living room.
oldasrocks is offline   Reply With Quote
Old 07-12-2015, 06:10 PM   #19
Auburn Boy
Denizen of the Gold Fields
 
Auburn Boy's Avatar
 
Join Date: Aug 2008
Posts: 8,391
Thanks: 2,250
Thanked 1,082 Times in 642 Posts
Do like my neighbor did..,

Simply feed your chickens to THE BEARS.

__________________
(\__/)
(='.'=) This is Bunny. Copy and paste bunny into your
(")_(") signature to help her gain world domination
Can't leave the Siwwy Wabbit behind!!
Auburn Boy is offline   Reply With Quote
Old 12-27-2015, 09:47 PM   #20
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
big update at genbank with 44 new genomes, from 2014 and early 2015
(so, ~ after one year)
40 mutations were fully established in Iowa in April/May
(as the latest available) after only 5 months
for a yearly rate of 96 mutations or 0.73e-3 per site per year,
more than anything that I'm aware of except maybe
some vaccine escapes in Egypt or China

Code:
                                                                             00000000001111111122 00000000111122 000001111111111122 000000000000000000111111111111 000000011 000000000001111111111 00000000 000000 
                                                                             01455668990134457900 23445569269912 588890013344456700 001122333344566679011223444556 336778904 000156667780111122233 23346789 135667 
                                                                             26356222773530303457 55164944825660 146991556822930802 225945013426112410115446136495 128246688 556514475541066603400 92359912 082571 
                                                                             41987472255654237553 27480149190283 007490048623168316 022268050239384240305785571901 567347278 094802620842247975648 47496431 247035 
-codon-position-------------------------------------------------------------- 21        1  1  1         21    21      2 2   1   1 1 212        1      2  2  2  1 1  2    21  2212  1  2111  21212    1  2     2211 
---Index---------------------------------------------------------------------AAAGAAAGCTTGGTGCGGAG AGGGAGGAGACCGA GGAGCCTGTATGGGGACC TCAGGCCCCTTTTCATGGTTCATCGTCGGC GTAGTCAGT TTTGATGGCGCAATGCTTAGG GCGGTCTA CCTAAG 
   1 >AmIndex/h5n2,2014//,USA,H5N8                                           .................... .............. .................. .............................. ......... ..................... ........ ......        0      0 ,      0      0       1:>AmIndex/h5n2,2014//,USA,H5N8                                           
   2 >A/NPintail/Oregon/AH0003871/2015(H5N2),2015/01/12,USA,H5N2-            .........C.T........ .............. ...A......C....... ....................A......... ......... ............G.A...... ........ ......       15      7 ,     15      7       2:>A/NPintail/Oregon/AH0003871/2015(H5N2),2015/01/12,USA,H5N2-            
   3 >A/NPintail/WA/40964/2014,2014/12/08,USA,H5N2                           .........C.T........ .............. ------------------ ....................A......... ......... ............G.A...... ........ ......       90     23 ,      7      5       3:>A/NPintail/WA/40964/2014,2014/12/08,USA,H5N2                           
   4 >A/NPintail/Washington/195365/2014(H5N2),2014/12/23,USA,H5N2-           .........C.......... .............. ...A......C....... ....................A......... ......... ..................... ........ ......       13      4 ,     13      4       4:>A/NPintail/Washington/195365/2014(H5N2),2014/12/23,USA,H5N2-           
   5 >A/Ml/Washington/195246/2014(H5N2),2014/12/08,USA,H5N2-                 .........C.......... .............. ...A......C....... .T..................A......... ......... ..................... ........ ......       13      5 ,     13      5       5:>A/Ml/Washington/195246/2014(H5N2),2014/12/08,USA,H5N2-                 
   6 >A/Ck/WA/3490-18/2015,2015/01/29,USA,H5N2                               .G.......C.......... .........C.... ...A......C....... .T..................A......... ......... ......A.A............ ........ ......       23      9 ,     23      9       6:>A/Ck/WA/3490-18/2015,2015/01/29,USA,H5N2                               
   7 >A/Ml/Oregon/AH0008887/2015(H5N2),2015/01/07,USA,H5N2-                  .........C.......... .........C.... ...A......C....... .T..................A......... ........C ......A.A............ ......C. ......       18     10 ,     18     10       7:>A/Ml/Oregon/AH0008887/2015(H5N2),2015/01/07,USA,H5N2-                  
   8 >A/Ml/Oregon/AH0003952/2015(H5N2),2015/01/05,USA,H5N2-                  .........C.......... .............. ...A......C....... .T...T..............A......... ......... ........A............ ........ ......       12      7 ,     12      7       8:>A/Ml/Oregon/AH0003952/2015(H5N2),2015/01/05,USA,H5N2-                  
   9 >A/Ml/Washington/196262/2015(H5N2),2015/01/01,USA,H5N2-                 ........TC.......... .............. ...A......C....... .T..................A......... ......... CCC.......T....T..... ...A.... ......       21     12 ,     21     12       9:>A/Ml/Washington/196262/2015(H5N2),2015/01/01,USA,H5N2-                 
  10 >A/Ml/Washington/195810/2014(H5N2),2014/12/23,USA,H5N2-                 ........TC.......... .............. ...A......C....... .T..................A......... ......... CCC.......T....T..... ...A.... ......       16     12 ,     16     12      10:>A/Ml/Washington/195810/2014(H5N2),2014/12/23,USA,H5N2-                 
  11 >A/Ml/Oregon/195547/2014(H5N2),2014/12/22,USA,H5N2-                     .........C...C...... .............. ...A......C....... .T..................A......... ......... ..................... ........ ......       13      6 ,     13      6      11:>A/Ml/Oregon/195547/2014(H5N2),2014/12/22,USA,H5N2-                     
  12 >A/Ck/BC/FAV8/2014,2014/12/03,Canada,H5N2                               .........C...C...... .....A........ ...A..C...C....... .T..................AG........ ......... .......A...T.......T. ........ ......       12     12 ,     12     12      12:>A/Ck/BC/FAV8/2014,2014/12/03,Canada,H5N2                               
  13 >A/Ck/BC/FAV9/2014,2014/12/03,Canada,H5N2                               .........C.......... .....A........ ...A..C...C....... .T..................AG........ ......... ...........T.......T. ........ ......       19     10 ,     19     10      13:>A/Ck/BC/FAV9/2014,2014/12/03,Canada,H5N2                               
  14 >A/CGs/Washington/197619/2014(H5N2),2014/12/30,USA,H5N2-                .........C.......... .............. ...A......C....... .T..................A......... ......... ..................... ........ ......       17      5 ,     17      5      14:>A/CGs/Washington/197619/2014(H5N2),2014/12/30,USA,H5N2-                
  15 >A/Tk/BC/FAV10/2014,2014/12/02,Canada,H5N2                              .........C.......... .............. ...A......C....... .T..................A......... ..G...... .......A............. ........ ......       15      7 ,     15      7      15:>A/Tk/BC/FAV10/2014,2014/12/02,Canada,H5N2                              
  16 >A/WoodDk/Oregon/AH0007257/2015(H5N2),2015/01/03,USA,H5N2-              .........C.......A.. .............. ..GA......C......T .T..................A......... ......... ..................... ........ ......       12      8 ,     12      8      16:>A/WoodDk/Oregon/AH0007257/2015(H5N2),2015/01/03,USA,H5N2-              
  17 >A/Pheasant/WA/3147-2/2015,2015/01/26,USA,H5N2                          .........C.......A.. .............. ..GA......C......T .T..................A......... ......... ..................... ........ ......       19      8 ,     19      8      17:>A/Pheasant/WA/3147-2/2015,2015/01/26,USA,H5N2                          
  18 >A/WoodDk/Oregon/AH0007244/2015(H5N2),2015/01/03,USA,H5N2-              .........C.......A.. .............. ..GA......C......T .T..................A......... ......... ..................... ........ ......       12      8 ,     12      8      18:>A/WoodDk/Oregon/AH0007244/2015(H5N2),2015/01/03,USA,H5N2-              
  19 >A/WoodDk/Oregon/AH0007263/2015(H5N2),2015/01/03,USA,H5N2-              .........C.......A.. .............. ..GA......C......T .T..................A......... ...A..... ..................... ........ ......       18      9 ,     18      9      19:>A/WoodDk/Oregon/AH0007263/2015(H5N2),2015/01/03,USA,H5N2-              
  20 >A/NPintail/Oregon/AH0003967/2015(H5N2),2015/01/05,USA,H5N2-            ..G......C.......A.. .............. ..GA......C......T .T..................A......... ......... ..................... .......G ..C...       15     11 ,     15     11      20:>A/NPintail/Oregon/AH0003967/2015(H5N2),2015/01/05,USA,H5N2-            
  21 >A/Ml/Idaho/AH0007412/2015(H5N2),2015/01/17,USA,H5N2-                   .........C.......A.. .T.........A.G ..GA......C......T .T.............C...CA...A..... ......... ...A.............C... .....T.G ..C.C.       23     20 ,     23     20      21:>A/Ml/Idaho/AH0007412/2015(H5N2),2015/01/17,USA,H5N2-                   
  22 >A/Ml/Idaho/AH0007413/2015(H5N2),2015/01/17,USA,H5N2-                   .........C.......A.. .T.........A.G ..GA......C......T .T.............C...CA...A..... ......... ...A.............C... .....T.G ..C.C.       20     20 ,     20     20      22:>A/Ml/Idaho/AH0007413/2015(H5N2),2015/01/17,USA,H5N2-                   
  23 >A/Tk/WA/61-22/2014,2014/12/30,USA,H5N2                                 .......A.C.......A.. .............. ..GA......C......T .TG.................A.....T... ......... .................C... .......G ..C...       15     14 ,     15     14      23:>A/Tk/WA/61-22/2014,2014/12/30,USA,H5N2                                 
  24 >A/DomesticDuck/WA/61-16/2014,2014/12/30,USA,H5N2                       .......A.C.......A.. G.....A....... ..GA......C......T .TGA................A.....T... ......C.. ................CC... .......G ..C..A       22     20 ,     22     20      24:>A/DomesticDuck/WA/61-16/2014,2014/12/30,USA,H5N2                       
  25 >A/Ck/WA/61-9/2014,2014/12/30,USA,H5N2                                  .......A.C.......A.. G.....A....... ..GA......C......T .TGA................A.....T... A.....C.. ................CC... .......G ..C..A       22     21 ,     22     21      25:>A/Ck/WA/61-9/2014,2014/12/30,USA,H5N2                                  
  26 >A/AGWTeal/Oregon/AH0012403/2015(H5N2),2015/01/14,USA,H5N2-             .........C.......A.. .............. ..GA......C......T .T..................A......... .......A. .................C... .......G ..C...       17     12 ,     17     12      26:>A/AGWTeal/Oregon/AH0012403/2015(H5N2),2015/01/14,USA,H5N2-             
  27 >A/Ml/Oregon/AH0003821/2014(H5N2),2014/12/20,USA,H5N2-                  .........C.......A.. .............. ..GA......C......T .T..................A......... .......A. .................C... .......G ..C...       14     12 ,     14     12      27:>A/Ml/Oregon/AH0003821/2014(H5N2),2014/12/20,USA,H5N2-                  
  28 >A/Ml/Washington/196865/2015(H5N2),2015/01/10,USA,H5N2-                 .........C.......A.. .............. ..GA......C......T .T..................A......... ......... .................C... .......G ..C...       18     11 ,     18     11      28:>A/Ml/Washington/196865/2015(H5N2),2015/01/10,USA,H5N2-                 
  29 >A/AGWTeal/Idaho/AH0011899/2015(H5N2),2015/01/18,USA,H5N2-              ..G......C.......A.. .............. ..GA......C......T .T..................A......... ......... ..................... .......G ..C...       19     11 ,     19     11      29:>A/AGWTeal/Idaho/AH0011899/2015(H5N2),2015/01/18,USA,H5N2-              
  30 >A/Ck/Oregon/A01819044/2015,2015/02/11,USA,H5N2                         .........C.......A.. .............. ..GA......C......T .T..................A......... ......... ..................... .......G ..C...       19     10 ,     19     10      30:>A/Ck/Oregon/A01819044/2015,2015/02/11,USA,H5N2                         
  31 >A/NShoveler/Oregon/AH0007339/2015(H5N2),2015/01/03,USA,H5N2-           .........C.......A.. ...A.......... ..GA......C......T .T.........CC.......A......... ......... .................C... .......G ..C...       19     14 ,     19     14      31:>A/NShoveler/Oregon/AH0007339/2015(H5N2),2015/01/03,USA,H5N2-           
  32 >A/NShoveler/Oregon/AH0007332/2015(H5N2),2015/01/03,USA,H5N2-           .........C.......A.. ...A.......... ..GA......C......T .T.........CC.......A......... ......... ....G............C... .......G ..C...       18     15 ,     18     15      32:>A/NShoveler/Oregon/AH0007332/2015(H5N2),2015/01/03,USA,H5N2-           
  33 >A/NShoveler/Oregon/AH0007337/2015(H5N2),2015/01/03,USA,H5N2-           .........C.......A.. ...A.......... ..GA......C......T .T.........CC.......A......... ......... .................C... .......G ..C...       16     14 ,     16     14      33:>A/NShoveler/Oregon/AH0007337/2015(H5N2),2015/01/03,USA,H5N2-           
  34 >A/Tk/Arkansas/7791-1/2015,2015/03/08,USA,H5N2                          ...A.....C.......AG. .............. ..GA.....GC......T .T.........C........A......... ......... .........A.......C... .......G ..C...       30     16 ,     30     16      34:>A/Tk/Arkansas/7791-1/2015,2015/03/08,USA,H5N2                          
  35 >A/Ck/Kansas/8395-3/2015,2015/03/12,USA,H5N2                            G........C.......AG. .............. A.GA.....GC......T .T..................A......... ..GA.T... .....C...A.......C... .......G ..C...       29     20 ,     29     20      35:>A/Ck/Kansas/8395-3/2015,2015/03/12,USA,H5N2                            
  36 >A/SnowGs/Missouri/15-011246-1/2015(H5N2),2015/03,USA,H5N2-             G........C.......AG. .............. A.GA.....GC......T .T..................A......... ..G..T..C ....GC...A.......C... .......G ..C...       27     21 ,     27     21      36:>A/SnowGs/Missouri/15-011246-1/2015(H5N2),2015/03,USA,H5N2-             
  37 >A/Tk/Minnesota/7172-1/2015,2015/02/27,USA,H5N2                         G........C.......AG. .............. A.GA.....GC......T .T..............A...A......... ..G...... .....C...A.......C... .......G ..C...       26     19 ,     26     19      37:>A/Tk/Minnesota/7172-1/2015,2015/02/27,USA,H5N2                         
  38 >A/Tk/Missouri/7458-1/2015,2015/03/06,USA,H5N2                          .........C....A..AG. .............. A.GA.....GC......T .T..................A......... ..G.A.... .....C...A.......C... .......G ..C...       25     19 ,     25     19      38:>A/Tk/Missouri/7458-1/2015,2015/03/06,USA,H5N2                          
  39 >A/Tk/Iowa/11762-1/2015,2015/04/12,USA,H5N2                             ...AG....C.......AG. ..A...A.....T. A.GA.T...GCA.....T .T.........C........A......... ..G.A.... .....C...A.......C..A .......G ..CC..       32     28 ,     32     28      39:>A/Tk/Iowa/11762-1/2015,2015/04/12,USA,H5N2                             
  40 >A/Tk/Minnesota/9892-2/2015,2015/03/26,USA,H5N2                         ....G....C.......AG. ..A...A.....T. A.GA.T....C......T .T.........C........A......... A.G.A.... .....C...A.......C..A .......G ..CC..       31     26 ,     31     26      40:>A/Tk/Minnesota/9892-2/2015,2015/03/26,USA,H5N2                         
  41 >A/Snowy Owl/Wisconsin/198399/2015(H5N2),2015/04/13,USA,H5N2-           .........C.......AG. ..A...A....... A.GA.T...GC......T .T.........C........A......... A.G.A.... .....C...A.......C..A .......G ..CC..       39     25 ,     39     25      41:>A/Snowy Owl/Wisconsin/198399/2015(H5N2),2015/04/13,USA,H5N2-           
  42 >A/Cooper's hawk/Minnesota/198225/2015(H5N2),2015/04/14,USA,H5N2-       .........C.......AG. ..A...A...T... A.GA.T...GC......T .T.........C....A...A......... ..G.A.... .....C...A.......C..A .......G ..CC..       31     26 ,     31     26      42:>A/Cooper's hawk/Minnesota/198225/2015(H5N2),2015/04/14,USA,H5N2-       
  43 >A/Tk/Minnesota/9845-4/2015,2015/03/25,USA,H5N2                         .........C.......AG. ..A...A...T... A.GA.T...GC......T .T.........C........A......... ..G.A.... .....C...A.......C..A .......G ..CC..       28     25 ,     28     25      43:>A/Tk/Minnesota/9845-4/2015,2015/03/25,USA,H5N2                         
  44 >A/Ck/Iowa/13542-2/2015,2015/04/25,USA,H5N2                             .........C..A....AG. ..A.C.AGC.T... A.GA.T...GCA.....T CT.......C.C..G...A.A.......A. .CG.A.... .....C...A...C....G.A ....C..G ..CC..       38     38 ,     38     38      44:>A/Ck/Iowa/13542-2/2015,2015/04/25,USA,H5N2                             
  45 >A/Ck/Iowa/14322-6/2015,2015/05/01,USA,H5N2                             .........C..A....AG. ..A.C.AGC.T... A.GA.T...GCA.....T CT..A....C.C..G...A.A.......A. .CG.A.... .....C...A...C....G.A ....C..G ..CC..       43     39 ,     43     39      45:>A/Ck/Iowa/14322-6/2015,2015/05/01,USA,H5N2                             
  46 >A/Tk/Iowa/14319-1/2015,2015/05/01,USA,H5N2                             .........C..A....AG. ..A.C.AGC.T... A.GA.T...GCA.....T CT..A....C.C..G...A.A.......A. .CG.A.... .....C...A...C....G.A ....C..G ..CC..       40     39 ,     40     39      46:>A/Tk/Iowa/14319-1/2015,2015/05/01,USA,H5N2                             
  47 >A/Ck/Iowa/14399-4/2015,2015/04/30,USA,H5N2                             .........C..A....AG. ..A.C.AGC.T... A.GA.T...GCA.....T CT..A....C.C..G...A.A......AA. .CG.A.... .....C...A...C....G.A ....C..G ..CC..       47     40 ,     47     40      47:>A/Ck/Iowa/14399-4/2015,2015/04/30,USA,H5N2                             
  48 >A/Ck/Iowa/04-20/2015,2015/04/20,USA,H5N2                               .........C..A....AG. ..A.C.AGC.T... A.GA.T...GCA.....T CT..A....C.C..G...A.A.......A. .CG.A.... .....C...A...C....G.A ....C..G ..CC..       40     39 ,     40     39      48:>A/Ck/Iowa/04-20/2015,2015/04/20,USA,H5N2                               
  49 >A/Tk/Iowa/14318-1/2015,2015/04/30,USA,H5N2                             .........C..A....AG. ..A.C.AGC.T... A.GA.T...GCA.....T CT..A....C.C..G...A.A.......A. .CG.A.... .....C...A...C....G.A ....C..G ..CC..       41     39 ,     41     39      49:>A/Tk/Iowa/14318-1/2015,2015/04/30,USA,H5N2                             
  50 >A/Ck/Iowa/14589-1/2015,2015/05/04,USA,H5N2                             .........C..A....AG. ..A.C.AGC.T... ------------------ CT..A....C.C..G...A.A.......A. .CG.A.... .....C...A...C....G.A ....C..G ..CC..      115     49 ,     32     31      50:>A/Ck/Iowa/14589-1/2015,2015/05/04,USA,H5N2                             
  51 >A/Tk/Iowa/13541-1/2015,2015/04/25,USA,H5N2                             .........C..A....AG. ..A.C.AGC.T... A.GA.T...GCA.....T CT..A....C.C..G...A.A.......A. .CG.A.... .....C...A...C....G.A ....C..G ..CC..       42     39 ,     42     39      51:>A/Tk/Iowa/13541-1/2015,2015/04/25,USA,H5N2                             
  52 >A/CGs/Kansas/197850/2015(H5N2),2015/03/13,USA,H5N2-                    .G.......C..A....AG. ..A.C.AGC.T... ------------------ CT..A....C.C..G...A.A.......A. .CG.A.... .....C...A...C....G.A ....C.CG ..CC..      120     51 ,     37     33      52:>A/CGs/Kansas/197850/2015(H5N2),2015/03/13,USA,H5N2-                    
  53 >A/AWigeon/Washington/196336/2015(H5N1),2015/01/02,USA,H5N1-            ......G........T.... -------------- ------------------ .....T..T.C..T...T...........T --------- --------------------- ..T..... ------      290     77 ,     10      9      53:>A/AWigeon/Washington/196336/2015(H5N1),2015/01/02,USA,H5N1-            
  54 >A/AWigeon/Washington/196340/2015(H5N1),2015/01/02,USA,H5N1-            ......G............. -------------- ------------------ .....T..T.C..T...T...........T --------- --------------------- ..T..... ------      293     76 ,     13      8      54:>A/AWigeon/Washington/196340/2015(H5N1),2015/01/02,USA,H5N1-            
  55 >A/AGWTeal/WA/195750/2014,2014/12/29,USA,H5N1                           ......G........T.... -------------- ------------------ .....T..T.C..T...T.........A.T --------- --------------------- ..T..... ------      291     78 ,     11     10      55:>A/AGWTeal/WA/195750/2014,2014/12/29,USA,H5N1                           
  56 >A/AWigeon/Oregon/AH0012525/2015(H5N8),2015/01/18,USA,H5N8-             .................... -------------- ------------------ .....T...........T...........T --------- --------------------- ........ TA....      254     67 ,      7      5      56:>A/AWigeon/Oregon/AH0012525/2015(H5N8),2015/01/18,USA,H5N8-             
  57 >A/CGs/Oregon/AH0012452/2015(H5N8),2015/01/18,USA,H5N8-                 .................... -------------- ------------------ .....T...........T...........T --------- --------------------- ........ TA....      257     67 ,     10      5      57:>A/CGs/Oregon/AH0012452/2015(H5N8),2015/01/18,USA,H5N8-                 
  58 >A/Tk/California/K1500169-1.2/2015,2015/01/21,USA,H5N8                  .................... -------------- .................. .....T...........T...........T --------- --------------------- ........ TA....      177     49 ,     13      5      58:>A/Tk/California/K1500169-1.2/2015,2015/01/21,USA,H5N8                  
  59 >A/Ml/Oregon/195536/2014(H5N8),2014/12/24,USA,H5N8-                     .................... -------------- .................. .....T...........T...........T --------- --------------------- ..T..... T.....      178     49 ,     14      5      59:>A/Ml/Oregon/195536/2014(H5N8),2014/12/24,USA,H5N8-                     
  60 >A/Peregrine Falcon/Washington/196426/2014(H5N8),2014/12/29,USA,H5N8-   .................... -------------- .A..............T. .......A..............CT.C.... --------- --------------------- .T...... ......      179     51 ,     15      7      60:>A/Peregrine Falcon/Washington/196426/2014(H5N8),2014/12/29,USA,H5N8-   
  61 >A/AWigeon/Washington/195968/2014(H5N8),2014/12/30,USA,H5N8-            .................... -------------- .A..............T. ......TA..............CT.C.... --------- --------------------- .T...... ......      181     52 ,     17      8      61:>A/AWigeon/Washington/195968/2014(H5N8),2014/12/30,USA,H5N8-            
  62 >A/Ml/Idaho/AH0005955/2014(H5N8),2014/12/22,USA,H5N8-                   .....G........A.A... -------------- .A..T..A....A..TT. ......TA...............T.C.... --------- --------------------- AT...... ......      181     59 ,     17     15      62:>A/Ml/Idaho/AH0005955/2014(H5N8),2014/12/22,USA,H5N8-                   
  63 >A/Ml/Idaho/AH0005954/2014(H5N8),2014/12/22,USA,H5N8-                   .....G..........A... -------------- .A..T..A....A..TT. ......TA...............T.C.... --------- --------------------- AT...... ......      182     58 ,     18     14      63:>A/Ml/Idaho/AH0005954/2014(H5N8),2014/12/22,USA,H5N8-                   
  64 >A/Ml/Nevada/AH0006855/2015(H5N8),2015/01/23,USA,H5N8-                  .....G..........A... -------------- .A.....A....A..TT. ......TA...............T.C.... --------- --------------------- .T...... ......      181     56 ,     17     12      64:>A/Ml/Nevada/AH0006855/2015(H5N8),2015/01/23,USA,H5N8-                  
  65 >A/AWigeon/Utah/AH0007824/2015(H5N8),2015/01/02,USA,H5N8-               .....G..........A... -------------- .A.....A....A..TT. ......TA...............T.C.... --------- --------------------- .T...... ......      179     56 ,     15     12      65:>A/AWigeon/Utah/AH0007824/2015(H5N8),2015/01/02,USA,H5N8-               
  66 >A/Ml/Idaho/AH0008597/2015(H5N8),2015/01/07,USA,H5N8-                   .....G..........A... -------------- .A.....A....A..TT. ......TA...............T.C.... --------- --------------------- .T...... ......      183     56 ,     19     12      66:>A/Ml/Idaho/AH0008597/2015(H5N8),2015/01/07,USA,H5N8-                   
  67 >A/Ck/California/15-004912/2015(H5N8),2015/02/06,USA,H5N8-              .....G..........A... -------------- .A.....A....A..TT. ......TA...............T.C.... --------- --------------------- .T...... ......      181     56 ,     17     12      67:>A/Ck/California/15-004912/2015(H5N8),2015/02/06,USA,H5N8-              
  68 >A/Bald Eagle/Idaho/15-002892-2/2015(H5N8),2015/01/20,USA,H5N8-         .....G..........A... -------------- .A.....A....A..TT. ......TA...............T.C.... --------- --------------------- .T...... ......      180     56 ,     16     12      68:>A/Bald Eagle/Idaho/15-002892-2/2015(H5N8),2015/01/20,USA,H5N8-         
  69 >A/NPintail/Washington/196271/2014(H5N8),2014/12/29,USA,H5N8-           .................... -------------- .A............A.T. .......A...............T.C.... --------- --------------------- .T...... ......      180     51 ,     16      7      69:>A/NPintail/Washington/196271/2014(H5N8),2014/12/29,USA,H5N8-           
  70 >A/AWigeon/Washington/195205/2014(H5N8),2014/12/16,USA,H5N8-            .................... -------------- .A............A.T. .......A...............T.C.... --------- --------------------- .T...... ......      172     51 ,      8      7      70:>A/AWigeon/Washington/195205/2014(H5N8),2014/12/16,USA,H5N8-            
  71 >A/Gyrfalcon/WA/41088-6/2014,2014/12/08,USA,H5N8                        .................... -------------- .A............A.T. .......A...............T.C.... --------- --------------------- .T...... ......      172     51 ,      8      7      71:>A/Gyrfalcon/WA/41088-6/2014,2014/12/08,USA,H5N8                        
  72 >A/AWigeon/Washington/195198/2014(H5N8),2014/12/16,USA,H5N8-            ...................T -------------- .A............A.T. .......A...............T.C.... --------- --------------------- .T...... ......      172     52 ,      8      8      72:>A/AWigeon/Washington/195198/2014(H5N8),2014/12/16,USA,H5N8-            
  73 >A/AWigeon/Washington/195198/2014(H5N8),2014/12/16,USA,H5N8-            ...................T -------------- .A............A.T. .......A...............T.C.... --------- --------------------- .T...... ......      172     52 ,      8      8      73:>A/AWigeon/Washington/195198/2014(H5N8),2014/12/16,USA,H5N8-            
  74 >A/Ck/Oregon/41613-2/2014,2014/12/16,USA,H5N8                           ..........C......... -------------- .A......C....A..T. .......A...............T.C.... --------- --------------------- .T...... ......      173     53 ,      9      9      74:>A/Ck/Oregon/41613-2/2014,2014/12/16,USA,H5N8                           
  75 >A/Guinea Fowl/Oregon/41613-1/2014,2014/12/16,USA,H5N8                  ..........C......... -------------- .A......C....A..T. .......A...............T.C.... --------- --------------------- .T...... ......      173     53 ,      9      9      75:>A/Guinea Fowl/Oregon/41613-1/2014,2014/12/16,USA,H5N8                  
                                                                                                                                                                                                                   
---Index---------------------------------------------------------------------AAAGAAAGCTTGGTGCGGAG AGGGAGGAGACCGA GGAGCCTGTATGGGGACC TCAGGCCCCTTTTCATGGTTCATCGTCGGC GTAGTCAGT TTTGATGGCGCAATGCTTAGG GCGGTCTA CCTAAG 
-codon-position-------------------------------------------------------------- 21        1  1  1         21    21      2 2   1   1 1 212        1      2  2  2  1 1  2    21  2212  1  2111  21212    1  2     2211 
                                                                             00000000001111111122 00000000111122 000001111111111122 000000000000000000111111111111 000000011 000000000001111111111 00000000 000000 
                                                                             01455668990134457900 23445569269912 588890013344456700 001122333344566679011223444556 336778904 000156667780111122233 23346789 135667 
                                                                             26356222773530303457 55164944825660 146991556822930802 225945013426112410115446136495 128246688 556514475541066603400 92359912 082571 
                                                                             41987472255654237553 27480149190283 007490048623168316 022268050239384240305785571901 567347278 094802620842247975648 47496431 247035
[- after genotype = new]
__________________
a chart says more than 1000 words

Last edited by gsgs; 12-28-2015 at 11:22 AM.
gsgs is offline   Reply With Quote
Old 01-07-2016, 11:13 AM   #21
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
today there are 91 mallard sequences from Southcentral Alaska at genbank,
sampled between Sep.22,2014 and Sep.24,2014 , 11 genomes and 3 additional HAs.
None of them matches the new Asian strain, detected in Dec.2014.
7 of the NAs from H5N2s do however match the reassorted American NA
of the new hp H5N2 variant. All 7 have nucleotide "T" at position 635
while the new hp H5N2s have nucleotide "C" at that position.
2,2,2,3,3,4,5 differences to the new N2-index in total, so very close.

ftp://ftp.ncbi.nih.gov/genomes/INFLU...fluenza_na.dat
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Reply

Tags
avian, flu, scientists, scrambling, send, viruses

Thread Tools Search this Thread
Search this Thread:

Advanced Search
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

Forum Jump


All times are GMT -4. The time now is 04:22 PM.


Powered by vBulletin®
Copyright © Jelsoft Enterprises Ltd.