Go Back   This Blue Marble, a Global Current Events Discussion Forum > Health and Medicine > Flu Clinic

Flu Clinic A special wing of TBM's Health and Medicine forum set aside for discussing all issues related to influenza, pH1N1, H5N1 or seasonal. Please use the subrooms as appropriate.

Reply
 
Thread Tools Search this Thread Display Modes
Old 11-17-2014, 01:21 AM   #1
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
Default H5N8 in Europe

3 cases of Asian H5N8 ("successor" of H5N1)

Heinrichswalde,NE-Germany,Nov.05,30000 turkeys
Hekendorp,Utrecht,South-Netherlands,Nov.16 , 150000 ducks
Nafferton,NE-England,Nov.16, 6000 ducks

duck breeding farm in East Yorkshire, Driffield-area
first case in the UK since 2008
Some 6,000 ducks will be culled.
Defra said the flu strain had been identified as the H5 virus, but stressed it was not the H5N1 strain.

in Jan-Mar 2014 there were many outbreaks in South Korea,
13M poultry culled


flutrackers.com currently doesn't work in IE, other browsers work


---------------------
I'm speculating that migrating Bewick's swans are attracted by the
smell from poultry farms
__________________
a chart says more than 1000 words

Last edited by gsgs; 11-19-2014 at 02:49 AM.
gsgs is offline   Reply With Quote
The Following 2 Users Say Thank You to gsgs For This Useful Post:
AndreaCA (11-17-2014), ukmum (11-17-2014)
Old 11-17-2014, 04:25 PM   #2
ukmum
Member
 
ukmum's Avatar
 
Join Date: Aug 2008
Location: Berkshire, UK
Posts: 3,778
Thanks: 2,498
Thanked 1,475 Times in 576 Posts
Looks likely this is just the start of an UK outbreak, I would expect more farms to have it soon.
ukmum is offline   Reply With Quote
Old 11-17-2014, 06:44 PM   #3
Malcolm
Senior Level 3
 
Malcolm's Avatar
 
Join Date: Aug 2008
Location: Australia
Posts: 3,350
Thanks: 2
Thanked 273 Times in 198 Posts
There is no immediate danger to human butttttttt...........

http://www.dw.de/european-h5n8-bird-...ans/a-18069482
Malcolm is offline   Reply With Quote
Old 11-18-2014, 06:27 AM   #4
ukmum
Member
 
ukmum's Avatar
 
Join Date: Aug 2008
Location: Berkshire, UK
Posts: 3,778
Thanks: 2,498
Thanked 1,475 Times in 576 Posts
Quote:
Originally Posted by Malcolm View Post
There is no immediate danger to human butttttttt...........

http://www.dw.de/european-h5n8-bird-...ans/a-18069482
Im more worried about a goose shortage for Christmas
ukmum is offline   Reply With Quote
Old 11-18-2014, 06:28 PM   #5
Malcolm
Senior Level 3
 
Malcolm's Avatar
 
Join Date: Aug 2008
Location: Australia
Posts: 3,350
Thanks: 2
Thanked 273 Times in 198 Posts
There will probably be human cases...........????
W.H.O. is scared and not of a goose shortage at Christmas

http://www.dailymail.co.uk/news/arti...duck-farm.html
Malcolm is offline   Reply With Quote
Old 11-19-2014, 01:27 AM   #6
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
there were no human cases in Korea earlier this year,
despite 13M poultry destroyed

in ferrets the virus was low symptomatic (interim results\
in mice less than H5N1


http://www.nature.com/emi/journal/v3...mi201475a.html
http://vet.snu.ac.kr/eng/aavs/meetin...3KisoonKim.pdf (July,2014)



H5N8 has one amino acid less at the cleavage-site than H5N1.
(typically: the more the deadlier)

Code:
...RNSPL-RERRRKKR-GLF...,Fujian-H5N1
...RNSPQ-GERRRKKR-GLF...,Qinghai-H5N1 (Europa,2006)
...RNSPQ-RERRRKKR-GLF...,Indonesien-H5N1
...RNNPL-REKRRK-R-GLF...,Korea-H5N8-a (2 sequenzen)
...RNSPL-RERRRK-R-GLF...,Korea-H5N8-b  (34 Sequenzen)
...RNVPQ-KETR-----GLF...,low-pathogenic H5N1,A/teal/Germany/WV632/2005
__________________
a chart says more than 1000 words

Last edited by gsgs; 11-19-2014 at 02:42 AM.
gsgs is offline   Reply With Quote
Old 11-19-2014, 06:35 AM   #7
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
Defra confirms H5N8 in England. Same strain as in Netherlands and Germany
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 11-19-2014, 08:43 AM   #8
Exodia
Khan of the Golden Horde
 
Exodia's Avatar
 
Join Date: Aug 2008
Location: Southeast PA
Posts: 11,098
Thanks: 2,518
Thanked 4,599 Times in 2,089 Posts
Quote:
Originally Posted by gsgs View Post
there were no human cases in Korea earlier this year,
despite 13M poultry destroyed

in ferrets the virus was low symptomatic (interim results\
in mice less than H5N1
I wonder if since ferrets were low symptomatic, if human cases would even be be noticeable.
__________________
"Now, mark my words. So long as we are a young and virtuous people, this instrument will bind us together in mutual interests, mutual welfare, and mutual happiness. But when we become old and corrupt, it will bind us no longer" - Alexander Hamilton about the US Constitution.
Exodia is offline   Reply With Quote
Old 11-19-2014, 11:45 AM   #9
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
they tested >300 sera of risk persons, no antibodies
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
The Following User Says Thank You to gsgs For This Useful Post:
Exodia (11-19-2014)
Old 11-19-2014, 03:01 PM   #10
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
780G in segment 7 means that the first strain is Amantadine sensitive, fwiw


Code:
                                                                             0000000001111111111111 000000111111112222 000000001111111112 00000000000000001111 00000000111 00000000000011 000 000000000 
                                                                             0233357880133445667889 345788001133990011 003557890002222451 01123444455568990024 03344688124 00000011468802 379 111233446 
                                                                             5601683467838377898395 684945013646010367 014149734894568603 31989145966881280669 11236808584 12258947490253 083 678449356 
                                                                             5324348921281837652900 975605651138847545 984335909558407434 11986663028016717843 28462408319 54539131264849 903 830199660 
-codon-position--------------------------------------------------------------1222 2  1   11 2        121  11  2    11    2     22       1 1 1  22 1111    2 12    1  2 1     12212 1   1       2 11 1   
---Index---------------------------------------------------------------------AGGCGAGGCCTTAGTACCCCAA CTCCTAAACGCTAGACGT CAACAAACCAAGAAAGTA GAAGCCCTGCAAATTGAGCG AAAGCAGCTGC AAACCCCTATCACT GAA AAGAACCAG 
   1 >Index/h5n8g1a,0-15669                                                  ...................... .................. .................. .................... ........... .............. ... .........        0      0 ,      0      0       1:>Index/h5n8g1a,0-15669                                                  
   2 >A/breeder duck/Korea/Gochang1/2014,2014/01/16,South Korea,H5N8,Avian   ...T....A........T..G. ........T......AT. TG.....T......G..G .................... ..G........ .G.........G.. .G. G....T...       18     18 ,     18     18       2:>A/breeder duck/Korea/Gochang1/2014,2014/01/16,South Korea,H5N8,Avian   
   3 >A/duck/Zhejiang/W24/2013,2013/11/14,China,H5N8,Avian                   G........T.CGA.G...... T..A.C...A..G.G... ..CT....A..A...... AGG..T.C.....A..GAAA .G..A.ATCA. G.GTTTT..CT..C ..G .C.G..T..       45     45 ,     45     45       3:>A/duck/Zhejiang/W24/2013,2013/11/14,China,H5N8,Avian                   
   4 >A/duck/Zhejiang/6D18/2013,2013/12/14,China,H5N8,Avian                  ....AGAA..C...G.A.TT.. T.T.CCGG..TC.AG..C .....G...GT.GG.AC. ...AT...AA.GG.CAG... CG.A.G....T G.GTTT.CG...A. A.G .CAGG..TA       57     57 ,     57     57       4:>A/duck/Zhejiang/6D18/2013,2013/12/14,China,H5N8,Avian                  
   5 >A/Baikal teal/Korea/H52/2014,2014/01/20,South Korea,H5N8,Avian         .AAT.............T..GG .C......T.......T. TG..G.GT......G..G ......T...G......... ..G........ .G.........G.. .G. G....T...       24     24 ,     24     24       5:>A/Baikal teal/Korea/H52/2014,2014/01/20,South Korea,H5N8,Avian         
                                                                                                                                                                                                        
---Index---------------------------------------------------------------------AGGCGAGGCCTTAGTACCCCAA CTCCTAAACGCTAGACGT CAACAAACCAAGAAAGTA GAAGCCCTGCAAATTGAGCG AAAGCAGCTGC AAACCCCTATCACT GAA AAGAACCAG 
-codon-position--------------------------------------------------------------1222 2  1   11 2        121  11  2    11    2     22       1 1 1  22 1111    2 12    1  2 1     12212 1   1       2 11 1   
                                                                             0000000001111111111111 000000111111112222 000000001111111112 00000000000000001111 00000000111 00000000000011 000 000000000 
                                                                             0233357880133445667889 345788001133990011 003557890002222451 01123444455568990024 03344688124 00000011468802 379 111233446 
                                                                             5601683467838377898395 684945013646010367 014149734894568603 31989145966881280669 11236808584 12258947490253 083 678449356 
                                                                             5324348921281837652900 975605651138847545 984335909558407434 11986663028016717843 28462408319 54539131264849 903 830199660

Code:
                                                                                  000000000000001111111112 0000000000000001111111111111111111111122 000000000000000000000011111111111111112 00000000000000000000000111111111111111111 000000000011111 000000000000000001111 0000000 00000000000000000000 
                                                                                  011122333456880013457880 0002333444458990111223344555577778899901 001122223344557788899900012223466788990 01233334555666777888899001111134444445556 022346678812234 013333444445567780003 1344667 00112222333344555666 
                                                                                  126906037156025687875127 0571245023865030679062505147813597705850 397738990418562827906712632563003077665 16700495037899159005603290017880788883448 559550847940714 240237001245692933670 6624082 17390025123513337569 
                                                                                  969856933102490427905876 7129484032338007148003118299101110273986 665762670220614120490970917102882167256 54049949061103558078113626961265324791141 487406479736506 689102251678146146258 3394073 25130554560106782101 
-codon-position-------------------------------------------------------------------1 1 12  1 12 1 2  11     1      1   2   2 11   1   11   2 1 2       1 2 2   1 1 11     1  1     1   12  1  2 1 11 221   12 2   1   22 1  1  2211221              2  21           1 2 1 1  1         2121 2 2  21 12  1 
---Index--------------------------------------------------------------------------CTAGGTATTCACGCAGCGAATAAG GTTATAAATCGAGTCTGAAAACGTGCAGTGGGCCTAGAAT GGAATCGACGACGGCATGGGCGGGAACGGCTGACAAATC GGGGCCACTGCATTCAAAAGTACACAACGCCCCGAGGGAGT AGAGATGGACGTCCC CGGCATGAACTGGACGTGAGC CCTTAGG CAGGGCACCAACTTGGCAGC 
   1 >Index/h5n8g1b,0-15669                                                       ........................ ........................................ ....................................... ......................................... ............... ..................... ....... ....................        0      0 ,      0      0       1:>Index/h5n8g1b,0-15669                                                       
   2 >A/Baikal teal/Korea/H66/2014,2014/01/21,South Korea,H5N8,Avian              ........................ ........................................ ....................................... ......................................... ............... ...................A. ....... ....................        1      1 ,      1      1       2:>A/Baikal teal/Korea/H66/2014,2014/01/21,South Korea,H5N8,Avian              
   3 >A/mallard/Korea/H297/2014,2014/01/29,South Korea,H5N8,Avian                 .........T...........G.. ........................................ ......................A.........G...... .....................G...T............... ............T.. ....G................ ....... ....................        8      8 ,      8      8       3:>A/mallard/Korea/H297/2014,2014/01/29,South Korea,H5N8,Avian                 
   4 >A/Baikal teal/Korea/H68/2014,2014/01/22,South Korea,H5N8,Avian              ........................ A....................................... ....................................... ...............................T......... ............... .....A............... .....A. ..................A.        5      5 ,      5      5       4:>A/Baikal teal/Korea/H68/2014,2014/01/22,South Korea,H5N8,Avian              
   5 >A/white-fronted goose/Korea/H231/2014,2014/01/28,South Korea,H5N8,Avian     ........................ .................G..G....T.............. .................A..................... ...A.................................A... ...........A... ..................... ....... .G....G.............        9      9 ,      9      9       5:>A/white-fronted goose/Korea/H231/2014,2014/01/28,South Korea,H5N8,Avian     
   6 >A/bean goose/Korea/H328/2014,2014/02/01,South Korea,H5N8,Avian              ........................ ...........G.....G..G..C................ ............A.......................... .......................................T. ............... ..................... ....... ....................        6      6 ,      6      6       6:>A/bean goose/Korea/H328/2014,2014/02/01,South Korea,H5N8,Avian              
   7 >A/breeder chicken/Korea/H250/2014,2014/01/28,South Korea,H5N8,Avian         .....C..........T....... ................AG..G................... .....T....G............................ ..A....................G................. ............... ..................... ....... ....................        9      9 ,      9      9       7:>A/breeder chicken/Korea/H250/2014,2014/01/28,South Korea,H5N8,Avian         
   8 >A/bean goose/Korea/H53/2014,2014/01/20,South Korea,H5N8,Avian               ........................ .......G.T.........G...............G.... .....A.....T........................... ......................................... ............... ..................... ....... .....A.....T........        8      8 ,      8      8       8:>A/bean goose/Korea/H53/2014,2014/01/20,South Korea,H5N8,Avian               
   9 >A/Baikal teal/Korea/H96/2014,2014/01/23,South Korea,H5N8,Avian              ........................ ..............................A......... .............A.......A................. ..............A.......................... ............... ........G............ ....... ....................        5      5 ,      5      5       9:>A/Baikal teal/Korea/H96/2014,2014/01/23,South Korea,H5N8,Avian              
  10 >A/Baikal teal/Korea/H41/2014,2014/01/19,South Korea,H5N8,Avian              ..............G......... ........................................ .............A......................... ......................................... ............... ..................... ....... ....................        2      2 ,      2      2      10:>A/Baikal teal/Korea/H41/2014,2014/01/19,South Korea,H5N8,Avian              
  11 >A/breeder chicken/Korea/H122/2014,2014/01/24,South Korea,H5N8,Avian         ..C..................... .C..C.............G..................... ...C................................G.. ....................C.................... ............... ..................... ....... ...............A....        8      8 ,      8      8      11:>A/breeder chicken/Korea/H122/2014,2014/01/24,South Korea,H5N8,Avian         
  12 >A/breeder duck/Korea/H128/2014,2014/01/25,South Korea,H5N8,Avian            ..C....C................ ........................................ ....A.................................. ......................................... C.............. T.................... ....... ...............A....        6      6 ,      6      6      12:>A/breeder duck/Korea/H128/2014,2014/01/25,South Korea,H5N8,Avian            
  13 >A/broiler duck/Korea/H145/2014,2014/01/25,South Korea,H5N8,Avian            ..C..................... ........................................ .........................G............. ......................................... ............... T.................... ..C.... ...............A....        5      5 ,      5      5      13:>A/broiler duck/Korea/H145/2014,2014/01/25,South Korea,H5N8,Avian            
  14 >A/breeder duck/Korea/H158/2014,2014/01/26,South Korea,H5N8,Avian            ..C..................... ........................................ ................C..............A....... ....T.................................... ..G............ ..................... ...C... .......T.......A....        8      8 ,      8      8      14:>A/breeder duck/Korea/H158/2014,2014/01/26,South Korea,H5N8,Avian            
  15 >A/broiler duck/Korea/H65/2014,2014/01/21,South Korea,H5N8,Avian             ..C........T............ ..C..................................T.. ..................................C.... .............................T........... ............... ..............A...... ....... ....A........G.A....       10     10 ,     10     10      15:>A/broiler duck/Korea/H65/2014,2014/01/21,South Korea,H5N8,Avian             
  16 >A/Baikal teal/Korea/H84/2014,2014/01/22,South Korea,H5N8,Avian              ..C..................... ........................................ ....................................... ...........................T............. ............... ..............T...... ....... ..........G....A....        5      5 ,      5      5      16:>A/Baikal teal/Korea/H84/2014,2014/01/22,South Korea,H5N8,Avian              
  17 >A/broiler duck/Korea/H48/2014,2014/01/20,South Korea,H5N8,Avian             ....................C... ..........C..................A.........C .................................T..... A........A..................A............ ............... ..................... ......A ..............A.....       10     10 ,     10     10      17:>A/broiler duck/Korea/H48/2014,2014/01/20,South Korea,H5N8,Avian             
  18 >A/broiler duck/Korea/H49/2014,2014/01/20,South Korea,H5N8,Avian             ........................ ...........................A...........C ....................................... .........A..A...............A............ ............... ..................... ......A ...A..........A.A...        9      9 ,      9      9      18:>A/broiler duck/Korea/H49/2014,2014/01/20,South Korea,H5N8,Avian             
  19 >A/bean goose/Korea/H40/2014,2014/01/19,South Korea,H5N8,Avian               ........................ .............C.......................... ....................................... .........A...C........................... ............... ................C.... ....C.. T...................        6      6 ,      6      6      19:>A/bean goose/Korea/H40/2014,2014/01/19,South Korea,H5N8,Avian               
  20 >A/mallard/Korea/H207/2014,2014/01/27,South Korea,H5N8,Avian                 ........................ ............A........................... ......................................T ......................................... ........G.....T ..................... ....... ....................        4      4 ,      4      4      20:>A/mallard/Korea/H207/2014,2014/01/27,South Korea,H5N8,Avian                 
  21 >A/breeder duck/Korea/H249/2014,2014/01/28,South Korea,H5N8,Avian            ....A..............G.... ........................................ A...................A................A. ......................................... ............... ..................... ....... ..A.................        6      6 ,      6      6      21:>A/breeder duck/Korea/H249/2014,2014/01/28,South Korea,H5N8,Avian            
  22 >A/waterfowl/Korea/S005/2014,2014/02/15,South Korea,H5N8,Avian               .C....C................. .................................YK..... ......A..A............................. ..................C...T.................C ....GC...T..... ..........C..C....... ....... ...................T       15     15 ,     15     15      22:>A/waterfowl/Korea/S005/2014,2014/02/15,South Korea,H5N8,Avian               
  23 >A/broiler duck/Korea/H31/2014,2014/01/19,South Korea,H5N8,Avian             .C................C..... ........................................ ...........................A........... ................G.C.....................C ....G....T..... ..................... ....... ....................        8      8 ,      8      8      23:>A/broiler duck/Korea/H31/2014,2014/01/19,South Korea,H5N8,Avian             
  24 >A/breeder duck/Korea/H200/2014,2014/01/27,South Korea,H5N8,Avian            .C........G.......C..... ..............T......................... ...........................A........... ..........T.....G.C...............G.A...C ....G....T..... ..................... ....... ....................       13     13 ,     13     13      24:>A/breeder duck/Korea/H200/2014,2014/01/27,South Korea,H5N8,Avian            
  25 >A/broiler duck/Korea/H29/2014,2014/01/18,South Korea,H5N8,Avian             .C................C..... ........................................ ...........................A........... ................G.C.....................C ....G....T..... ..................... ....... ....................        8      8 ,      8      8      25:>A/broiler duck/Korea/H29/2014,2014/01/18,South Korea,H5N8,Avian             
  26 >A/Korean native chicken/Korea/H257/2014,2014/01/28,South Korea,H5N8,Avian   .C................C....A ........................................ ...........................A........... ................G.C.....................C ....G....T..... ..................... .T..... ....................       10     10 ,     10     10      26:>A/Korean native chicken/Korea/H257/2014,2014/01/28,South Korea,H5N8,Avian   
  27 >A/broiler duck/Korea/H32/2014,2014/01/19,South Korea,H5N8,Avian             .C................C..... ...............................T........ ...........................A........... ................G.C.......C...T.........C ....G....T..... ..................... ....... ....................       11     11 ,     11     11      27:>A/broiler duck/Korea/H32/2014,2014/01/19,South Korea,H5N8,Avian             
  28 >A/Baikal teal/Korea/H80/2014,2014/01/22,South Korea,H5N8,Avian              .C................C..... .....G.........................A........ .A.....................A............... .A..............G.C.....................C ....G....T..... .......G............. ....... ....................       13     13 ,     13     13      28:>A/Baikal teal/Korea/H80/2014,2014/01/22,South Korea,H5N8,Avian              
  29 >A/Coot/Korea/H81/2014,2014/01/22,South Korea,H5N8,Avian                     .C................C..... .....G.................................. .A.....................A............... .A..............G.C.....................C ....G....T..... .......G............. ....... ....................       12     12 ,     12     12      29:>A/Coot/Korea/H81/2014,2014/01/22,South Korea,H5N8,Avian                     
  30 >A/baikal teal/Korea/Donglim3/2014,2014/01/17,South Korea,H5N8,Avian         .C................C..... .....G.................................. ....................................... ................G.C.....T...............C ....G....T..... ..................... ....... ....................        9      9 ,      9      9      30:>A/baikal teal/Korea/Donglim3/2014,2014/01/17,South Korea,H5N8,Avian         
  31 >A/broiler duck/Korea/H133/2014,2014/01/25,South Korea,H5N8,Avian            .C................C..... ........................................ ....................................... ................G.C.....................C ....G..A.T..... ...............A..... ....... .........T..........       10     10 ,     10     10      31:>A/broiler duck/Korea/H133/2014,2014/01/25,South Korea,H5N8,Avian            
  32 >A/mallard/Korea/W452/2014,2014/02/05,South Korea,H5N8,Avian                 .C................C..... ........................................ ...............G...T........A.......... .....T.....C....G.CA............A.......C .A..G....T..... ..A...A.............. ....... ....................       17     17 ,     17     17      32:>A/mallard/Korea/W452/2014,2014/02/05,South Korea,H5N8,Avian                 
  33 >A/broiler duck/Korea/H47/2014,2014/01/20,South Korea,H5N8,Avian             .C................C..... ........................................ ....................................... ................G.C.....................C ....G....T..... ..................... ....... ............C.......        8      8 ,      8      8      33:>A/broiler duck/Korea/H47/2014,2014/01/20,South Korea,H5N8,Avian             
  34 >A/Baikal teal/Korea/H62/2014,2014/01/21,South Korea,H5N8,Avian              .C...................... ......................................T. ....................................... ........A.......G.C.....................C ....G....T...T. .........T........... T...... ....................       11     11 ,     11     11      34:>A/Baikal teal/Korea/H62/2014,2014/01/21,South Korea,H5N8,Avian              
  35 >A/tundra swan/Korea/H411/2014,2014/02/06,South Korea,H5N8,Avian             .C.............T........ ...............C........A............... ....................................... ......G...........C.....................C ....G....T..... ....................T ....... ....................       10     10 ,     10     10      35:>A/tundra swan/Korea/H411/2014,2014/02/06,South Korea,H5N8,Avian             
  36 >A/spot-billed duck/Korea/H455-42/2014,2014/02/08,South Korea,H5N8,Avian     .C..........A....A...... ........C.................G............. ........................G.............. ..................C..............A......C ....G.A..T..... .T................... ....... ....................       13     13 ,     13     13      36:>A/spot-billed duck/Korea/H455-42/2014,2014/02/08,South Korea,H5N8,Avian     
  37 >A/common teal/Korea/H455-30/2014,2014/02/08,South Korea,H5N8,Avian          TC...........T........C. ................................T....... ..................A.................... .................TC...................T.C ....G....T..... ...........AA........ ....... ....................       14     14 ,     14     14      37:>A/common teal/Korea/H455-30/2014,2014/02/08,South Korea,H5N8,Avian          
  38 >A/broiler duck/Korea/Buan2/2014,2014/01/17,South Korea,H5N8,Avian           .C....................C. ...G.................T..........T....... .......G..........A.................... ..................C.....................C ...AG....T..... ..................... ....... ....................       12     12 ,     12     12      38:>A/broiler duck/Korea/Buan2/2014,2014/01/17,South Korea,H5N8,Avian           
  39 >A/chicken/kumamoto/1-7/2014,2014/04/13,Japan,H5N8,Avian                     .C.A....C............... ......G...............A.....G.......A... ..G.....T.....A...A.......T..TC....G... .......T.......G...................A..... ..........A.... ...A.............AG.. ....... ........T........C..       24     24 ,     24     24      39:>A/chicken/kumamoto/1-7/2014,2014/04/13,Japan,H5N8,Avian                     
                                                                                                                                                                                                                                                                                                         
---Index--------------------------------------------------------------------------CTAGGTATTCACGCAGCGAATAAG GTTATAAATCGAGTCTGAAAACGTGCAGTGGGCCTAGAAT GGAATCGACGACGGCATGGGCGGGAACGGCTGACAAATC GGGGCCACTGCATTCAAAAGTACACAACGCCCCGAGGGAGT AGAGATGGACGTCCC CGGCATGAACTGGACGTGAGC CCTTAGG CAGGGCACCAACTTGGCAGC 
-codon-position-------------------------------------------------------------------1 1 12  1 12 1 2  11     1      1   2   2 11   1   11   2 1 2       1 2 2   1 1 11     1  1     1   12  1  2 1 11 221   12 2   1   22 1  1  2211221              2  21           1 2 1 1  1         2121 2 2  21 12  1 
                                                                                  000000000000001111111112 0000000000000001111111111111111111111122 000000000000000000000011111111111111112 00000000000000000000000111111111111111111 000000000011111 000000000000000001111 0000000 00000000000000000000 
                                                                                  011122333456880013457880 0002333444458990111223344555577778899901 001122223344557788899900012223466788990 01233334555666777888899001111134444445556 022346678812234 013333444445567780003 1344667 00112222333344555666 
                                                                                  126906037156025687875127 0571245023865030679062505147813597705850 397738990418562827906712632563003077665 16700495037899159005603290017880788883448 559550847940714 240237001245692933670 6624082 17390025123513337569 
                                                                                  969856933102490427905876 7129484032338007148003118299101110273986 665762670220614120490970917102882167256 54049949061103558078113626961265324791141 487406479736506 689102251678146146258 3394073 25130554560106782101
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 01-09-2015, 06:24 AM   #11
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
now the zoos ?
Rostock, Germany, 12 storks culled, ducks, ... zoo closed


if there are no new cases, then not all zoo-birds will be killed
all 500 birds including rare species (85 species in total) will be examined

it's a mystery how the virus entered, all birds were held in stables
or overroofed volieres


Von der Tötung aller Vögel im Zoo werde abgesehen, sofern es keine weiteren Nachweise des Virus gebe, sagte Backhaus am Donnerstag. Es sollen nun alle im Zoo gehaltenen Vögel untersucht werden. Laut Direktor Nagel hält der Zoo etwa 500 Vögel, darunter sehr seltene Arten. Auch Futtermittel und Einstreu würden untersucht. "Es ist ein Rätsel, wie das Virus zu den Vögeln gekommen ist", sagte Nagel. Sämtliche Vögel im Zoo seien in Stallgebäuden oder überdachten Volieren untergebracht
https://www.ndr.de/nachrichten/meckl...elpest172.html

--------update 2015/01/10---------------
Rostock zoo, 500 birds from 85 species

all 12 storks had H5N8

killed so far: 12 storks,5 geese, 25 ducks, 18 exotic birds see below


zwölf Störche, fünf Gänse und 25 Enten
Roten Sichler = Eudocimus ruber
18 Tiere getötet , weitere Ibisse und Nachtreiher und Seidenreiher.

Nachtreiher = Nycticorax nycticorax = black-crowned night heron
Roten Sichler = Eudocimus ruber = scarlet ibis
Seidenreiher = Egretta garzetta = little egret

---------------------------------------------------



[in German]
__________________
a chart says more than 1000 words

Last edited by gsgs; 01-11-2015 at 01:51 AM.
gsgs is offline   Reply With Quote
Old 01-11-2015, 07:43 AM   #12
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
and now Taiwan

several goose farms in several counties



the spread is more dynamic than H5N1 in 2004ff ,
but no humans got it so far


2015/01/13: 20 confirmed (14 H5N2, 6 H5N8), 45 "potentially infected"
__________________
a chart says more than 1000 words

Last edited by gsgs; 01-14-2015 at 01:14 AM.
gsgs is offline   Reply With Quote
Old 01-15-2015, 11:31 AM   #13
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
evolution of Fujian-H5 (segment 4 only) since 2005

each line is a virus-HA from genbank,2015/01/15 , 766 in total
each column is a nucleotide-position in HA

each black pixel denotes a mutation
white pixel: not available
orange pixel: no mutation, just as the Fujian index,consensus from 2005
Attached Images
File Type: gif h515fu.gif (18.7 KB, 2 views)
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 01-27-2015, 06:06 AM   #14
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
this is a bit difficult, since I have no access to the GISAID-sequences.
Some of the GISAID-members should be doing this analysis ...
but I don't see this.

The Canada H5N2 seems to have some mutations in common with the
Kumamoto,Miyazaki and Kagoshima-Crane sequences, that the European H5N8 has not.

As reference I use an artificial pre-H5N8 virus from ~2011 with the segments
from k1203,1-15,1-15,628,628,k1203,1-15,1-15.

From what I've heard, I conclude:

we had 3 H8N8 strains in Korea in early 2014.
One was quite different from the other 2 and from all the other H5N8 that we have now in Europe,
America,Japan,Russia and probably Taiwan and it was also somehow rarer than the other 2.
The other 2 ("A","B") are quite similar, they have 1 (10000000) resp. 4 (00022000) mutations in
the index compared to their common ancestor "AB".
Miyazaki,Kagoshima crane,Canada are A, while Europe,Chiba,Russia, are B.
Although A has only 1 mutation in the index, the available A-viruses
have strangely more mutations than those of B compared to AB.
Meanwhile I think that the Eutope viruses may well descend (almost)
directly from B, so the common ancestor were B itself.
It did split in July-August into the different variants that we had in
Germany,Netherlands,UK,Italy and also Chiba/Japan.

These viruses are quite distant from the bird-index , so they are probably poultry viruses,
they evolved for >~10years in poultry rather than in wild migrating waterfowl,
presumable in free range Chinese domestic ducks.
But now they went (back) to migratory birds and are quite successfully spread by them.
I do not expect them to enter the general wild waterfowl population in Europe and America,
i.e. mallards. These mallards, the original source of all flu, probably since centuries
basically only have flu-viruses close to the bird-index in the inner segments.
They can catch other variants, like H5N1 in 2004, but they don't compete so well
in mallards with the established viruses. Maybe it's because of the dabbling,
the waterborne transmission (vs.respiratory in chickens), maybe it's because
of the migrating and breeding patterns.
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 01-27-2015, 09:36 AM   #15
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
Asian H5N1 (reassorted) finally in America, the first sequence is published

Eurasian avian flu establishes in America for the first time since ~50 years,

AFAIR the first time that a full Eurasian virus (H5N8) spreads in America
and mingles with the American genepool

still, this barely gets any interest
how the times changed since 2005 !

just 9 google hits for A/turkey/BC/FAV10* , and most of these
are from me.

It took 50 days that the sequences were published,
American sequences are still withheld, European,Japanese,
Russian,Taiwan sequences from this season are still not
public. Some are at GISAID which calls themself "publically
available" but you must be a member, must sign to their
conditions, which is mainly that you mustn't publich their sequences.

Remember, what happened in 2006 ?
There was that semi-secret Los Alamos database and
Capua et.al. were calling for publication of H5N1 sequences
and that's why GISAID was founded. Meanwhile they banned Capua in 2013,
(for not enough secrecy, as I understood), they removed the original
declaration that GISAID-sequences must be uploaded to public genbank
after 6 months and more and more labs use GISAID instead of genbank.

And no reporters,researchers,health officials etc. seem to care.


I don't understand this.
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 02-05-2015, 05:33 AM   #16
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
Taiwan ~somehow~ published H5N2,H5N3,H5N8 sequences.
But not at genbank. They gave the amino-acid sequences on a webpage
(ai.gov.tw) and partial nucleotide-sequences as an image, that doesn't allow easy OCR.
This seems to be another strategy to maintain secrecy while still claiming
to have something published ?!

http://ai.gov.tw/redirect_file.php?id=398
http://ai.gov.tw/redirect_file.php?id=399
http://ai.gov.tw/redirect_file.php?id=400

ai.gov.tw/index.php?id=324

ai.gov.tw/redirect_file.php?id=208

ai.gov.tw/redirect_file.php?id=209

ai.gov.tw/index.php?id=324


http://ai.gov.tw/index.php?id=628


acid sequences
> To increase bird flu research, offer such vaccinations to pragmatic decision,
> announced by the Executive Yuan's Council of agriculture animal health
> tests and new H5N2, and H5N3 subtype H5N8 8 gene of avian influenza
> virus nucleic acid sequences such as the annex coupling.

Executive Council of Agriculture Animal Health Research Institute 02-26212111


someone please type these into the computer ...


http://www.newsmarket.com.tw/blog/64824/
[translate with google or bing. He also complains that sequences are not published at genbank)







still no European or Japanese or US-sequences from the new
strain at genbank
meanwhile >700 farms were infected in Taiwan
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 01-22-2016, 03:53 AM   #17
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
-------------------------------------------------------
http://link.springer.com/article/10....-2570-4#page-2
7782 Vogelgrippe-Proben in Russland in 2014 aus 37 Regionen
A/wigeon/Sakha/1/2014/H5N8 von Tracheal Spezimen von anas penelope
in Belaya Gora
-----------------------------------------------------------
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4414090/
Applying restriction measures according to European Union directive 94/2005 (14),
such as culling affected flocks, has been effective in stopping further spread of this
virus to other poultry farms. Epidemiologic investigations revealed no definite route
of introduction of the virus but have excluded incursion by infected turkey eggs or poults;
contaminated water, feed, or litter; and vehicles or persons having contact with infected
premises in South Korea or East Asia. Introduction by infected wild birds, perhaps
facilitated by contaminated litter, feed, water, fomites, or other substance cannot be
excluded because an internationally recognized site frequented by wild birds is near
the affected turkey farm.
Shortly before the start of the outbreak, large numbers of migratory birds were observed
on harvested fields near the premise. Fecal wild bird samples collected from the environment
around the farm were negative for influenza A(H5N8) virus RNA. However, a swab specimen
obtained from a healthy common teal (Anas crecca) shot from a flock of wild ducks on the
island of Ruegen, Germany, on November 17, 2014, showed positive results for
HPAI (H5N8) virus. ... Epidemiologic and phylogenetic data collected so far are insufficient
to establish definite pathways of introduction into Germany.

cited by
Dynamic changes in host gene expression associated with H5N8 ...infection in mice
Wild waterfowl migration and domestic duck density shape the epidemiology of highly
pathogenic H5N8 influenza in the Republic of Korea


-----------------------------------------------------------------

http://www.sciencedirect.com/science...67134815300721
Phylogenetic analysis of the highly pathogenic avian influenza (HPAI) H5 viruses causing
recent outbreaks in Taiwan showed that they belonged to the Asian HPAI H5 lineage,
clade 2.3.4.4 viruses, and were apparently introduced by migratory birds.

-------------------------------------------------------------------------
Genetic characterization of highly pathogenic H5 influenza viruses from poultry in Taiwan, 2015
Experimental infection of highly and low pathogenic avian influenza viruses to chickens, ducks,
tree sparrows, jungle crows, and black rats for the evaluation of their …
Lessons from the Largest Epidemic of Avian Influenza Viruses in Taiwan, 2015
Characterization of clade 2.3. 4.4 highly pathogenic H5 avian influenza viruses in ducks and chickens
The spread of HPAI H5 viruses in Asia, Europe and North America, which has been linked
to the transcontinental migration ...
Microbiological Hazards of Wild Birds and Free-Range Chickens
Corneal Opacity in Domestic Ducks Experimentally Infected With H5N1 Highly Pathogenic
Avian Influenza Virus
Intercontinental Spread of Asian-Origin H5N8 to
North America through Beringia by 255 Migratory Birds. J. Virol. 89:6521-6534. 2015. ...

The European and Japanese outbreaks of H5N8 derive from a single source population that
has most likely been dispersed along the long distance bird migratory …

----------------------------------------------------------

4 hours ago
2015 Fujian H5N8 In Wild Birds In Klamath County Oregon Have North American PA 12By niman, 25 Dec 2015 26 replies
----------------------------
Wednesday at 9:49 PM
2015 H5N8 Sequences from Taiwan
By niman, 23 Dec 2015 17 replies
----------------------------
Wednesday at 6:25 PM
N2 In Alaska Wild Birds Match Fujian H5N2 In North America
By niman, Wednesday at 11:21 AM 11 replies
------------------------------
Wild waterfowl migration and domestic duck density shape the epidemiology of highly
pathogenic H5N8 influenza in the Republic of Korea
------------------------------------------------
Weak negative associations between avian influenza virus infection and movement behaviour
in a key host species, the mallard Anas platyrhynchos
---------------------------------------------
The European and Japanese outbreaks of H5N8 derive from a single source population providing
evidence for the dispersal along the long distance bird
-----------------------------------------------------------------
http://www.eurosurveillance.org/imag...6/art21174.pdf
Phylogenetic analysis of highly pathogenic avian influenza A(H5N8) virus outbreak strains provides
evidence for four separate introductions and one between-poultry farm transmission in the Netherlands,
November 2014
...supports the hypothesis that H5N8 virus was exchanged between migratory wild waterfowl at
their breeding grounds in Siberia and from there was carried by migrating waterfowl to Europe.
-------------------------------------------------------------------
__________________
a chart says more than 1000 words

Last edited by gsgs; 01-22-2016 at 04:18 AM.
gsgs is offline   Reply With Quote
Reply

Tags
europe, h5n8

Thread Tools Search this Thread
Search this Thread:

Advanced Search
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

Forum Jump


All times are GMT -4. The time now is 08:37 AM.


Powered by vBulletin®
Copyright © Jelsoft Enterprises Ltd.