Go Back   This Blue Marble, a Global Current Events Discussion Forum > Health and Medicine > Flu Clinic

Flu Clinic A special wing of TBM's Health and Medicine forum set aside for discussing all issues related to influenza, pH1N1, H5N1 or seasonal. Please use the subrooms as appropriate.

Reply
 
Thread Tools Search this Thread Display Modes
Old 01-07-2015, 03:11 AM   #1
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
Default interesting new flu-viruses at genbank

I'm planning to post here new interesting viruses from my daily
genbank checking

usually by just editing the last posts so it isn't dumped for
the supposed majority of flu-sequence-ignorers


today:
A/swine/Kazakhstan/106/1985,H3N6 , KJ889412, full genome
http://www.ncbi.nlm.nih.gov/nuccore/KJ889412

avian Eurasian virus into swine, no genes from the swine H1N1 that
emerged in Europe 1979 (and partly went into Mexflu 2009)
paper about the origin of that strain, which had the Kazakhstan virus:
http://www.ncbi.nlm.nih.gov/pubmed/25073465

04,04,04,16,03,--,00,05* = 20
only 20 amino acids away from the (H3N8-)bird-index
(euroswine-1979 is 45 ,equine H3N8-1963 is 60 , panflu-1918 is 46,
H5N1-2004 is 48 , Qinghai-H5N1-2005 is 68)
segment 8=NS is the 2nd type
(2 types of NS as 16 types of HA,9 types of NA in birds)
I don't remember having ever seen a mammalean flu with 2nd type NS

----------------------------------------
I'm still waiting for the first viruses at genbank from the
new H5N8 and H5N2 strains that were found in Europe
and America lat 2014. [first Nov.05 in Germany]

It is very rare that Eurasian avian flu establishes (and mixes with
the gen-pool) in America or vice versa.
segment 1 for >100 years
segment 2 in ~1950
segment 3 in ~1970
these mixings were followed by pandemics in 1957 and 1968
--------------------------------------------------
__________________
a chart says more than 1000 words

Last edited by gsgs; 01-07-2015 at 09:03 AM.
gsgs is offline   Reply With Quote
The Following User Says Thank You to gsgs For This Useful Post:
Exodia (01-07-2015)
Old 01-18-2015, 03:30 AM   #2
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
we got 10 full genomes from China,2014 , H5N6 and related H5N1
in the last 3 days at genbank.
There was also a human H5N6 case, but the sequences
are not available to me.


here the 7 similar H5N6 viruses from Sichuan :
you can spot one likely reassortment of very similar H5N6s in #3

Code:
                                                      0001 2 001111 0 00011 0 00
                                                      5685 0 002466 7 24701 4 34
                                                      1016 4 349588 5 34001 1 60
                                                      0736 9 363836 9 64489 8 65
-codon-position--------------------------------------- 1      1       2 2   1   
---Index----------------------------------------------GAAC T TGCTGG T ACGAA A CG
2 >KM251533,A/chicken/Sichuan/NCJPL1/2014,H5N6        AC.T . ...C.. . C.... . T.
3 >KM251534,A/duck/Sichuan/NCJPL7/2014,H5N6           AC.T . CA.CAA . C.... . T.
1 >KM251532,A/Anas_crecca/Hubei/Chenhu1623-5/2014,H5N6..C. . CA..AA . ...C. . ..
7 >KM251538,A/environment/Sichuan/NCLL1/2014,H5N6     ..C. . CA..AA . ..... . ..
4 >KM251535,A/duck/Sichuan/NCXJ15/2014,H5N6           ..C. . ...... . ...C. . ..
5 >KM251536,A/duck/Sichuan/NCXJ16/2014,H5N6           .... C ..T... C .TA.G G .A
6 >KM251537,A/duck/Sichuan/NCXJ24/2014,H5N6           .... C ..T... C .TA.G G .A
that strain has already 17,10,18,--,10,--,16,26
amino-acid differences from the bird-index=avian consensus
in the 8 segments, so it evolved many years (>10?) in
poultry (or Chinese "domestic" ducks) after it had crossed over
from wild birds (duffing mallards)

(to compare:
1918-flu had 8,7,10,-,9,-,7,5 amino-acid differences
from the bird-index,
Qinghai H5N1 had 9,8,10,-,7,-,14,18
Eurasian swine(1978) that contributed 2 segments to mexflu
had 8,5,12,-,5,-,3,7 ;
human H3N2,(2012) had 42,20,35,--,42,--,27,46)

=================================
genbank influenza
http://www.ncbi.nlm.nih.gov/genomes/...ph-select.cgi?
currently doesn't work for me, I tried several browsers.
Whatever I select , I get 0 hits
=================================
__________________
a chart says more than 1000 words

Last edited by gsgs; 01-18-2015 at 04:53 AM.
gsgs is offline   Reply With Quote
Old 01-19-2015, 10:08 AM   #3
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
just some keywords, hoping someone will find it with google
genbank
influenza
January 2015
http://www.ncbi.nlm.nih.gov/genomes/...ase/select.cgi
doesn't work
zero hits
error

I'm not sure, since when this is
it probably did work on 2015/01/15 and surely on 2014/12/28
I also sent email to genbank, no response yet

http://jvi.asm.org/content/82/2/596.full
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 01-19-2015, 11:28 AM   #4
andy
Senior Level 5
 
andy's Avatar
 
Join Date: Aug 2008
Location: Gainesville, Florida
Posts: 5,444
Thanks: 589
Thanked 1,176 Times in 628 Posts
What's happening with H5N1 lately?
andy is offline   Reply With Quote
Old 01-20-2015, 12:28 PM   #5
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
reply from genbank :
There was a problem in the database and it has been fixed now.

strange that there was no note and apparently noone else
posted about it

OK, I may do an update on H5N1-sequences now ...
The old H5N1-thread is here:
https://flutrackers.com/forum/forum/...om/160446-h5n1

the news - you can find it elsewhere.
I remember CIDRAP reported about mutations in Egypt

------------------------------------
I downloaded all 354562 genbank nucleotide flu-sequences now
(567MB,fasta-format)
__________________
a chart says more than 1000 words

Last edited by gsgs; 01-20-2015 at 01:18 PM.
gsgs is offline   Reply With Quote
Old 01-22-2015, 11:51 AM   #6
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
one post for google

influenza
genbank
A79849
Z54293
CY015058
A/chicken/Brescia/1902(H7N7)


the alphabetically first and last codes of the influenza sequences at genbank
and the earliest dated one.

I mean, if someone in the world were looking for someone else who also analyses
these sequences, builds computer-readable files from it, how would he find me ?


influenza A , genbank, 2015/01/20
counts of sequences of the 189 types from flugenome.org
llz6.bas

Code:
     sum     A     B     C     D     E     F     G     H     I     J     K     L
--------------------------------------------------------------------------------
 1,30954, 7780,  340,14837,    5,   14,  543, 3391,   14,   11,  133, 3769,  117
 2,30900, 1853,  360,   12,13326,  550, 7063, 7487,   14,  235
 3,30790, 2035, 5707,  326, 5384,13768,   14,  241, 2592,  573,   21,  129
 5,31147, 8439,    9,  257,  154,  192, 7844,   35,14217
 7,41744, 1946,12638,   60,   21, 7400,19648,   31
41,29643,18668, 6924, 3471,  530,   50
42,  682,  170,   12,    3,  135,   38,   29,    4,  270,   21
43,30209,21375,  679,  653,  870,    1, 6631
44, 1829, 1279,   17,  518,   15
45, 6537,   30,  261,  590,    9,   12,   53,  123,  170,   30, 5241,   18
46, 1811, 1241,  229,   49,    6,   63,   25,  198
47, 2007,  972,   17,   24,   31,   11,  952
48,  178,  178
49, 3519,    7,  785, 2258,   56,   74,  119,  179,    8,   12,   21
4A,  798,  574,    1,    6,    9,  205,    3
4B,  646,  159,   39,  448
4C,  253,  216,   37
4D,  185,   75,   58,   52
4E,   21,   16,    5
4F,   16,   16
4G,   65,    9,   33,   23
61,24557, 5392, 1773,    7,   38,  880,12162,  145,  335,   49, 3714,   45,   17
62,18292,13646,  975,  195, 1171,  579,  219, 1313,    3,  191
63, 1039,  616,  368,   10,   32,    2,   11
64,  300,  198,   84,   18
65,  392,    1,   91,   11,  289
66, 2072, 1182,   64,  808,    9,    9
67,  915,    4,    6,   13,  265,   17,  552,   58
68, 2038, 1513,  265,  260
69,  890,  873,   17
81,28950, 7469,   11,  154,15308, 3771, 2230,    7
82, 3234,  827, 2377,   15,   11,    4
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 01-23-2015, 10:07 AM   #7
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
Canadian Frazer-valley H5N2 at genbank !
one full genome

A/turkey/BC/FAV10/2014(H5N2)

http://www.ncbi.nlm.nih.gov/nuccore/KP307954
http://www.ncbi.nlm.nih.gov/nuccore/KP307955
http://www.ncbi.nlm.nih.gov/nuccore/KP307956
http://www.ncbi.nlm.nih.gov/nuccore/KP307957
http://www.ncbi.nlm.nih.gov/nuccore/KP307958
http://www.ncbi.nlm.nih.gov/nuccore/KP307959
http://www.ncbi.nlm.nih.gov/nuccore/KP307960
http://www.ncbi.nlm.nih.gov/nuccore/KP307961


this Canada H5N2 has too many mutations to be a direct descendent
in segments 1,3,4,7,8 of the Korea strain from Jan.2014

but the common ancester could have been in summer or fall 2013



compared with the Korea-H5N8 index we have these changes:
(some of these probably preceed Korea,Jan,2014)


nucleotide mutations: (add 12 above 1020 in HA to get bitsc45-numbering]
Code:
>A/turkey/BC/FAV10/2014,2014/12/02
1,11,C126T,C498T,C705T,G745A,A753G,C891T,T975C,C1041T,C1998A,T2064C,G2070A
2,0
3,14,T174C,C645A,T654C,C720A,A777G,G837A,G859T,G894A,A927G,T1422C,C1498T,T1578C,T1581C,C1678T
4,14,C22T,G31A,A111G,G267A,A404G,A714G,C715A,G853A,C1107T,C1110T,C1155A,A1485G,G1535T,A1590G
5,0
6,0
7,0
8,2,T99C,A270G
amino-acid mutations:
Code:
>A/turkey/BC/FAV10/2014,2014/12/02
1,1,E249K
2,0
3,2,A287S,P560S
4,6,L8F,V11I,K135R,R239S,V285M,R512I
5,0
6,0
7,0
8,0

I can't link any of these mutations to other
(than Korea H5N8,Jan.2014) genbank-known viruses.
So since the common ancester in maybe fall 2013 these
evolve undetected and it may have gone to America
already in fall 2013



----------------------------------
from an OIE-report, 2015/01/20

H5N1 in a Green-winged Teal:Anas carolinensis(Anatidae)

Eurasian lineage genes (PB2, H5, NP, MP >99% identical to A/gyrfalcon/WA/41088/2014 H5N8);
North American lineage genes (PB1 {98% identical to A/Northern pintail/Washington/40964/2014 H5N2},
PA, N1, NS of North American LPAI wild bird lineage
---------------------------------------


I think that some of the extensive mutations in the Frazer valley virus
could be lab-created.It's the same lab that had the many mutations
in the Alberta swine with mexflu in May,2009 !
We don't see those mutations in other viruses, so the Frazer valley
segments 1,3,4,7,8 seem to be direct descendents of the
Korea/Jan-2014 strain

The same holds for the Kagoshima crane virus sequenced by
the University of Kagoshima : too many mutations.
And some of these mutations are apparently also in the
Frazer valley H5N2. That could mean that these mutations
naturally occur when they grow the virus in eggs in the lab.

I have no better explanation ATM


Code:
                                                              00000000000000000000000000000011111111111111111111111111111111111222222222 00000000000000000000000001111111111111111111111111111111111111112222222 000000000000000000000000000000000000000001111111111111111111111111111111111111111111111111222222 000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111 00000000000000000000000000000000000000000000111111111111111111111 0000000000000000000000000000000000000000000000000000000000000000000000000001111111111111111111111 000000000000000000000000000 0000000000000000000000000000000000000000000000 
                                                              01122223333444556667777777888900001122222333444555556667888899999000001112 00011122234456667888889990000001111111122223344444556667777889990000122 001111122233344555556667777778888888999990000001111233333334444445555556666666788888899999000111 000000000000111111112222222222233333333444444444445555666667778888899000001111234444555555667 00011111222233344444444555556667888888999999000011111122222334444 0000000000011111111111111222222233333444444455555566666667777777788899999990000001111122222233333 001122223344455555666777888 0011122222222222333333334444455555666667777778 
                                                              82302260134469785790455889799701341200568258029013382341133801259067790266 23935701537802590133455890113471224557905687904447995770158775890356005 590277859902356225681450226781235789236690057991134612338990123490457781347789634579915889277113 001222334488112558890012345668901233489012234666792559133371170555816224590159234788113669470 56812357346906702456689277893587122479013578112703345702367154447 1222344589901123334456779024456901267000145822445623356890124689922400015680244550448924458801235 280834687827812789012129156 0916801112335567034456881123523445034991136781 
                                                              86092740592488687595513064516554819203404903951750710510979451038140915436 43083719207947595614691438572916249179467314873693693174285023691457937 818945357925962354122549042709879024796792634680946047259344427486275814271895792486713362823283 781028010148140450152765405375698901592487945689482241512684514038829231927057100358565030111 19410534167769520465805209537441625004648751176270165931005165695 5245058391644900580495146766982466192568126657695846729763797581258336725352947044368075817917024 505973448704332988027534437 6975990195492610032537086706772492476145990897 
-codon-position-----------------------------------------------1 12 2              11   22 2               2  1  1     11            2  1               1      1    1  2   2 22                   2  1   1     11 11   1   221   1 2     1 1      1      1  1  1       1   12 1  11          1        1      2     122211 112 1   12 1 1      2  2  2 1 22211 211 1    2  12   1  11    2         1     12                                  21          22      1 2           2  2  1 1   221 2 2 1  2     1 1   1  1    1  1   2   1  11   1    22      1 1 1     1    2     22   1 12     2         1   1 211       2 1   2 1      21212  11211  1111112111 1 
---Index------------------------------------------------------ACGGCCATAGCCCCACACCCGAACGACCGTTTACTAACATGAGTGACCACCATGCGTATTCCATCCTGGGGAAA CACGACCAAAGGAAGAGTAAGATTGGATCGCGACACGGAGGACACTACTATCTTTAGGCCTGCGCTTTCAA AGTGTAAGATATGGGTGGGTGCTACCCACTCGGGCGAGTGCTTAACACTAGGTACCTATCTTCTCGTTCTTAACACTACATGGTATAGGGGAGAGT AATTCGGGGTAAAACACTACCGCGTTGGGCCCTCCCGCTAAAATGGATACGTGCTGATGACTTGGGTCGGAAGCCCCAATTCACTAGAGAATC ATTATTTGGTAAAATCCTGGCTTAAGAAACGTCTTTCGCGTTAGGGGCAGCACATCCTCCAGCCG GGAATAGTTTACGAAACTGTCATATCCTACCTCGCATATTAAACGCTTTGGCGGATTAATGAGGAGAAGAATTTAAAGCGCAGACCAGATTGGTTAA AGAGCGGACTAGCAAACTAGCGGCCTA CTCGAGGGTAAAAAAAAATCAACCATGTGTAAAGATTCGGACATTC 
   1 >Index/h5n8b/Korea-2014,2014/01/01,Korea,H5N8,Avian,1    .......................................................................... ....................................................................... ................................................................................................ ............................................................................................. ................................................................. ................................................................................................. ........................... ..............................................        0      0 ,      0      0       1:>Index/h5n8b/Korea-2014,2014/01/01,Korea,H5N8,Avian,1    
   2 >h5n8pre1:k1203;1-15;1-15;628;628;k1203;1-15;1-15        ...A......TT..GTG......TT.....G.G.C...GC..A....A..TG.AT..GCG.TGC.........G T...GT...G.AG.AGA.GG...CA..C..T..A...AC.AC...CGTC..T.....A.TGAT..C.C... G.CA.GG.C..G.AAC..AC........T.T.........T.CG.T.T..........C.G..C..C.....G.G..GT.C....C.AA....G.C ...C.C....GG.G...A.TT.TACC...A.TCA..AT..G.....GCCTA....ACC...C.A.A.TAAGG.T...G.CCT.T.C.....CT ...GC............C.....G..G.C...TC.....AC......T.........C.AG.T.A .A.GC.......A.......T..G.T......T..........T....AA.TA.G........A.A...GG.C.G..T.A.G..TT....C...... ....T.AG..G....G....T..T.CG T......A..G..........GA..CA.A....A...T.....C..      197    197 ,    197    197       2:>h5n8pre1:k1203;1-15;1-15;628;628;k1203;1-15;1-15        
   3 >h5n8pre2:628;1111;1111;k1203;sd1;6d18;1111;1111         ..........TT..GTG......TTC....G.G.....GC..A.AG.A..TG..TACGCG.TGC.......... TG..GT...G.AG.AGA.GG...CA..CT.T..A.T.AC.AC...CGTC..T.....A.TGAT..C.C... G.CA.GG.C....AAC..AC........T.T...........CG.T.T..........C.G..C..C.....G.G..GT.C.A..C.AA.AGAGCC .....AAAACGG.G...A.TT.TACC...A.T.G..AT..G....AGCCTA....ACCA..C...A.T.AG..T...G.C.T.T.C....GCT ...GC............C.....G..G.C...TC.............T.........C.AG.T.A .A.G......G.A....G..T.CG.T............G..G.TA...CA.T..G........A......G...G..T..AG.GTT....C...... G...T.AG..G....G....T..T.C. .......A..G..........GA..CA......A...T.....CG.      203    203 ,    203    203       3:>h5n8pre2:628;1111;1111;k1203;sd1;6d18;1111;1111         
   4 >H5N8pre3:m234;1112;1112;m234;m234;goch1;628;1112        G....A...ATT..GTGT.....TT.....G.G.....GC..A.AG.AGTTG..TACGCG.TG.....A...G. TG..GTT.GG..G.A.AAGG..GCAAGC.A..CAG..AC.ACTGTCGTC.C.C.C.A.ATGAT..CCC..C GAAA.GGA..G.AA.CTAACAT...AT.TGT..AT..ACA.CCGGTGTCGTACCTTGGCTG.T..ACCT..GG.G.AGTGCT.CCCGAAA...G.C GGA..C....GG.G.GTA.TT.TACC...AATCA..AT..G.....GCCTA....ACC...C.A.AGTAAGG.T...G.CCT.T.C.G...CT ...GC............C.....G..G.C...TC..T..........T.........C.A.TT.A AAG....CCCG.A....G..T..G.T............G....TA...CA.T..G........A..G...G...G..T...G.GTT....C...... ...ATAAG.CGA.GGGTGG.TA.T... ....G.T....C..G.......A..C....GGGA...T.....C..      274    274 ,    274    274       4:>H5N8pre3:m234;1112;1112;m234;m234;goch1;628;1112        
   5 >H5N8pre4:wy11;008;108;wy19;wy11;90;008;1904             ..A.G.GCG.TTT.GTG.T..G.TT.T.A.GCG..GGTGCAGAC.GTA..TGC.T.CGCGTTGC.T...AAG.. T.TAGTTG.GA.GGA.A.GGACGCAA.C...A.A..AATAAC...CGTCG.TCC.T..A.GATATC.CTGC G.CA.GGA.C...AAC..ACA..G.A..TG...AT..AC..CCGGT.TC.......G.C.G..C.ACC....GAG.GGT.C..C.C.AAA...G.C .....AA...GG.GT..AGTTATACCAA.A.T.ATTATA.GGCCTAGCCTACATGACCA..CC..A.TAAG.TT...GGC.T.TGC..A..CT GGCGCACAACGGGGCTT.AATCCGGAGGCAACTCCA.AT..CGAAAATGATGTGATTCTA..TTA .A...GA..G.TAGGGTCAG.G..ATTCGATCTATGCG.CG.G..TCCGAAT.AGCCGGCAGAAGAGTAGGCCCGTGTTA.GAGTTGACCCAACCGG .AGAT.AGT.G.T.GG.GGAT.ATT.. T.TA.A..CG.CGG..GGCTG.ATG.AC.A...AGCCTAAGTGC.T      400    400 ,    400    400       5:>H5N8pre4:wy11;008;108;wy19;wy11;90;008;1904             
   6 >A/turkey/BC/FAV10/2014,2014/12/02,Canada,H5N2,Avian,1   .T...........T.....TA.G....T.C...T..............................A.CA...... ----------------------------------------------------------------------- ....C................AC.A..G...AT..AG........................C..T....CC....T.................... ....T..A....G...............A..........G...................GA...A.........TTA.....G...T..G... ----------------------------------------------------------------- ------------------------------------------------------------------------------------------------- ........................... .C.............G..............................      274    274 ,     41     41       6:>A/turkey/BC/FAV10/2014,2014/12/02,Canada,H5N2,Avian,1   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
---Index------------------------------------------------------ACGGCCATAGCCCCACACCCGAACGACCGTTTACTAACATGAGTGACCACCATGCGTATTCCATCCTGGGGAAA CACGACCAAAGGAAGAGTAAGATTGGATCGCGACACGGAGGACACTACTATCTTTAGGCCTGCGCTTTCAA AGTGTAAGATATGGGTGGGTGCTACCCACTCGGGCGAGTGCTTAACACTAGGTACCTATCTTCTCGTTCTTAACACTACATGGTATAGGGGAGAGT AATTCGGGGTAAAACACTACCGCGTTGGGCCCTCCCGCTAAAATGGATACGTGCTGATGACTTGGGTCGGAAGCCCCAATTCACTAGAGAATC ATTATTTGGTAAAATCCTGGCTTAAGAAACGTCTTTCGCGTTAGGGGCAGCACATCCTCCAGCCG GGAATAGTTTACGAAACTGTCATATCCTACCTCGCATATTAAACGCTTTGGCGGATTAATGAGGAGAAGAATTTAAAGCGCAGACCAGATTGGTTAA AGAGCGGACTAGCAAACTAGCGGCCTA CTCGAGGGTAAAAAAAAATCAACCATGTGTAAAGATTCGGACATTC 
-codon-position-----------------------------------------------1 12 2              11   22 2               2  1  1     11            2  1               1      1    1  2   2 22                   2  1   1     11 11   1   221   1 2     1 1      1      1  1  1       1   12 1  11          1        1      2     122211 112 1   12 1 1      2  2  2 1 22211 211 1    2  12   1  11    2         1     12                                  21          22      1 2           2  2  1 1   221 2 2 1  2     1 1   1  1    1  1   2   1  11   1    22      1 1 1     1    2     22   1 12     2         1   1 211       2 1   2 1      21212  11211  1111112111 1 
                                                              00000000000000000000000000000011111111111111111111111111111111111222222222 00000000000000000000000001111111111111111111111111111111111111112222222 000000000000000000000000000000000000000001111111111111111111111111111111111111111111111111222222 000000000000000000000000000000000000000000000000000000000000000000000111111111111111111111111 00000000000000000000000000000000000000000000111111111111111111111 0000000000000000000000000000000000000000000000000000000000000000000000000001111111111111111111111 000000000000000000000000000 0000000000000000000000000000000000000000000000 
                                                              01122223333444556667777777888900001122222333444555556667888899999000001112 00011122234456667888889990000001111111122223344444556667777889990000122 001111122233344555556667777778888888999990000001111233333334444445555556666666788888899999000111 000000000000111111112222222222233333333444444444445555666667778888899000001111234444555555667 00011111222233344444444555556667888888999999000011111122222334444 0000000000011111111111111222222233333444444455555566666667777777788899999990000001111122222233333 001122223344455555666777888 0011122222222222333333334444455555666667777778 
                                                              82302260134469785790455889799701341200568258029013382341133801259067790266 23935701537802590133455890113471224557905687904447995770158775890356005 590277859902356225681450226781235789236690057991134612338990123490457781347789634579915889277113 001222334488112558890012345668901233489012234666792559133371170555816224590159234788113669470 56812357346906702456689277893587122479013578112703345702367154447 1222344589901123334456779024456901267000145822445623356890124689922400015680244550448924458801235 280834687827812789012129156 0916801112335567034456881123523445034991136781 
                                                              86092740592488687595513064516554819203404903951750710510979451038140915436 43083719207947595614691438572916249179467314873693693174285023691457937 818945357925962354122549042709879024796792634680946047259344427486275814271895792486713362823283 781028010148140450152765405375698901592487945689482241512684514038829231927057100358565030111 19410534167769520465805209537441625004648751176270165931005165695 5245058391644900580495146766982466192568126657695846729763797581258336725352947044368075817917024 505973448704332988027534437 6975990195492610032537086706772492476145990897
__________________
a chart says more than 1000 words

Last edited by gsgs; 01-25-2015 at 07:09 AM.
gsgs is offline   Reply With Quote
Old 01-28-2015, 12:43 PM   #8
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
lots (3153) of sequences from China today

mainly chickens from Jiangxi H10 or H9, many mixed,
Dec.2013-Apr.2014

no close neighbour of Europe-Korea-American H5N8

we have very few (~5) sequences from that strain before 2014


amino-acid differences from the bird-index=avian consensus :
http://magictour.free.fr/BITSCG0b.GIF
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 01-28-2015, 01:45 PM   #9
Sysiphus
Senior Level 6
 
Sysiphus's Avatar
 
Join Date: Aug 2008
Location: Seattle
Posts: 8,386
Thanks: 634
Thanked 1,684 Times in 981 Posts
Quote:
from an OIE-report, 2015/01/20

H5N1 in a Green-winged Teal:Anas carolinensis(Anatidae)

Eurasian lineage genes (PB2, H5, NP, MP >99% identical to A/gyrfalcon/WA/41088/2014 H5N8);
North American lineage genes (PB1 {98% identical to A/Northern pintail/Washington/40964/2014 H5N2},
PA, N1, NS of North American LPAI wild bird lineage
Interesting that it pulled in an LPAI N1 strain but was still HPAI. How does that work?
Sysiphus is offline   Reply With Quote
Old 01-29-2015, 03:56 AM   #10
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
HP is mainly determined by HA(H5) and in H5 and H7 you
usually see it directly by the length of the cleavage site
Asian H5N1 typically had 8 amino-acids, Fijian(2005) had 7,
LP usually has 4

there are some other mutations in other segments involved ...
but I don't think NA is so important here.
Well, sometimes there are deletions in NA, upto 20 amino-acids
in H5N1 and this had been contributed to increased virulence,
afair, in connection with H5 in Asia
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 02-07-2015, 07:14 AM   #11
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
Taiwan provides the latest H5N2,H5N3 and H5N8 sequences only as amino-acid sequences and as
partial, non-computer-readable nucleotide-sequences.
At http://ai.gov.tw
So I typed one partial segment of one virus
into the computer by hand, hoping that others type in some others and find this ...

This HA is very similar to the H5 from Canada, suggesting a common origin
in summer or fall 2014, after the outbreak in Korea in early 2014

Code:
>Index/h5n8g1b,0-15669
ATGGAGAAAATAGTGCTTCTTCTTGCAGTGGTTAGCCTTGTTAAAAGTGATCAGATTTGCATTGGTTACCATGCAAACAACTCAACAAAGCAGGTTGACACGATAATGGAAAAAAACGTCACTGTTACACATGCCCAAGACATACTGGAAAAGACACACAACGGGAAGCTCTGCGATCTTAATGGAGTGAAGCCCCTGATTCTAAAGGATTGTAGCGTAGCTGGGTGGCTCCTTGGAAATCCAATGTGCGACGAGTTCATCAGGGTGCCGGAATGGTCTTACATCGTGGAGAGGGCTAACCCAGCCAACGACCTCTGTTACCCAGGGACCCTCAATGACTATGAGGAACTGAAACACCTATTGAGCAGAATAAATCATTTTGAGAAAACTCTGATCATCCCCAAGAGTTCTTGGCCCAATCATGAAACATCATTAGGGGTGAGCGCAGCATGTCCATACCAGGGAGCATCCTCATTTTTCAGAAATGTGGTATGGCTCATCAAAAAGAACGATGCATACCCGACAATAAAGATAAGCTACAATAATACCAATCGGGAAGATCTTTTGATACTGTGGGGGATTCATCATTCCAACAATGCAGCAGAGCAGACAAATCTCTATAAAAACCCAGACACTTATGTTTCCGTTGGGACATCAACATTAAACCAGAGATTGGTGCCAAAAATAGCTACTAGATCCCAAGTAAACGGGCAACGTGGAAGAATGGATTTCTTCTGGACAATTTTAAAACCGAATGATGCAATCCACTTTGAGAGTAATGGAAATTTCATTGCTCCAGAATATGCATACAAAATTGTCAAGAAAGGGGACTCAACAATTATGAAAAGTGAAGTGGAGTATGGCCACTGCAACACCAAATGTCAAACTCCAATAGGGGCGATAAACTCTAGCATGCCATTCCACAATATACACCCTCTCACCATCGGGGAATGCCCCAAATACGTGAAGTCAAACAAATTAGTCCTTGCGACTGGGCTCAGAAATAGTCCTCTAAGAGAAAGAAGAAGAAAAAGAGGACTATTTGGAGCTATAGCAGGGTTTATAGAGGGAGGATGGCAGGGAATGGTAGACGGTTGGTATGGGTACCACCATAGCAATGAGCAGGGGAGTGGGTACGCTGCAGACAAAGAATCCACCCAAAAGGCAATAGATGGAGTTACCAATAAGGTCAACTCAATCATTGACAAAATGAACACTCAATTTGAGGCCGTTGGAAGGGAATTTAATAACTTAGAAAGGAGAATAGAGAATTTAAACAAGAAAATGGAAGACGGATTCCTAGATGTCTGGACTTATAATGCTGAACTTTTAGTTCTCATGGAAAATGAGAGAACTCTAGATTTCCATGACTCAAATGTCAAGAACCTTTACGACAAAGTCCGACTACAGCTTAGGGATAATGCAAAGGAGCTGGGTAATGGTTGTTTCGAGTTCTATCACAAATGTGATAACGAATGTATGGAAAGCGTAAGAAATGGGACGTATGACTACCCTAAGTATTCAGAAGAAGCAAGATTAAAAAGAGAAGAAATAAGCGGAGTGAAATTAGAATCAATAGGAACTTACCAAATACTGTCAATTTATTCAACAGTGGCGAGTTCCCTAGCACTGGCAATCATAGTGGCTGGTCTATCTTTATGGATGTGCTCTAATGGGTCGTTACAATGCAGAATTTGCATCTAA
>A/GS/TW/0104/2015(H5N2),segment 4,HA, partial
--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGCGTAGCTGGGTGGCTCCTTGGAAATCCAATGTGCGACGAGTTCATCAGGGTGCCGGAATGGTCTTACATCGTGGAGAGGGCTAACCCAGTCAACGACCTCTGTTACCCAGGGACCCTCAATGACTATGAGGAACTGAAACACCTATTGAGCAGAATAAATCATTTTGAGAAAACTCTGATCATCCCCAGGAGTTCTTGGCCCAATCATGAAACATCATTAGGGGTGAGCGCAGCATGTCCATACCAGGGAGCATCCTCATTTTTCAGAAATGTGGTATGGCTCATCAAAAAGAACGATGCATACCCGACAATAAAGATAAGCTACAATAATACCAATCGGGAAGATCTTTTGATACTGTGGGGGATTCATCATTCCAACAATGCAGCAGAGCAGACAAATCTCTATAAAAACCCAGACACTTATGTTTCCGTGGGGACATCAACATTAAACCAGAGATTGGTGCCAAAAATAGCTACTAGATCCCAAGTAAACGGGCAAAGTGGAAGAATGGGTTTCTTCTGGACAATTTTAAAACCGAATGATGCAATCCACTTTGAGAGTAATGGAAATTTCATTGCTCCAGAATATGCATACAAAATTGTCAAGAAAGGGGACTCAACAATTATGAAAAGTGAAATGGAGTATGGCCACTGCAACACCAAATGTCAAACTCCAATAGGGGCGATAAACTCTAGCATGCCATTCCACAATATACACCCTCTCACCATCGGGGAATGCCCCAAATACGTGAAGTCAAACAAATTAGTCCTTGCGACTGGGCTCAGAAATAGTCCTCTAAGAGAAAGAAGAAGAAAAAGAGGACTATTTGGAGCTATAGCAGGGTTTATAGAGGGAGGATGGCAGGGAATGGTAGACGGTTGGTATGGGTATCATCATAGCAATGAGCAGGGGAGTGGGTACGCTGCAGACAAAGAATCCACCCAAAAGGCAATAGATGGAGTTACCAATAAGGTCAACTCAATCATTGACAAAATGAACACTCAATTTGAGGCCGTTGGAAGGGAATTTAATAACTTAGAAAGGAGAATAGAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
>A/GS/TW/0142/2015(H5N3)
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATACCAATCGGGAAGATCTTTTGATATTGTGGGGGATTCATCATTCCAACAATGCAGCAGAGCAGACAAATCTCTATAAAAACCCAGACACTTATGTTTCCGTGGGGACATCAACATTAAACCAGAGATTGGTGCCAAAAATAGCTACTAGATCCCAAGTAAACGGGCAAAGTGGAAGAATGGATTTCTTCTGGACAATTTTAAAACCGAATGATGCAATCCACTTTGAGAGTAATGGAAATTTCATTGCTCCAGAATATGCATACAAAATTGTCAAGAAAGGGGACTCAACAATTATGAAAAGTGAAATGGAGTATGGCCACTGCAACACCAAATGTCAAACTCCAATAGGGGCGATAAACTCTAGCATGCCATTCCACAATATACACCCTCTCACCATCGGGGAATGCCCCAAATACGTGAAGTCAAACAAATTAGTCCTTGCGACTGGGCTCAGAAATAGTCCTCTAAGAGAAAGAAGAAGAAAAAGAGGACTATTTGGAGCTATAGCAGGGTTTATAGAGGGAGGATGGCAGGGAATGGTAGACGGTTGGTATGGGTATCATCATAGCAATGAGCAGGGGAGTGGGTACGCTGCAGACAAAGAATCCACCCAAAAGGCAATAGATGGAGTTACCAATAAGGTCAACTCAATCATTGACAAAATGAACACTCAATTTGAGGCCGTTGGAAGGGAATTTAATAACTTAGAAAGGAGAATAGAGAATTTAAACAAGAAAATGGAAGACGGATTCCTAGATGTCTGGACTTATAATGCTGAACTTTTAGTTCTCATGGAAAATGAGAGAACTCTAGATTTCCATGACTCAAATGTCAAGAACCTTTACGACAAAGTCCGGCTACAGCTTAGGGATAATGCAAAAGAGCTGGGTAATGGTTGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------

mutations in HA as compared to Korea,Jan,2014:
CDN,H5N2:G31A,A404G,C715A,G853A,C1107T,C1110T
TW,H5N2:C305T,A404G,T638G,C715A,A728G,G853A,C1107T ,C1110T
TW,H5N3:C571T,T648G,C715A,G853A,C1107T,C1110T,A140 4G,G1428A
__________________
a chart says more than 1000 words

Last edited by gsgs; 02-09-2015 at 03:05 PM.
gsgs is offline   Reply With Quote
Old 02-13-2015, 03:52 AM   #12
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
gyrfalcon Asian H5N8 from Washington, 2014/12/08 at genbank
segment 1segment 2segment 3segment 4segment 5segment 6segment 7segment 8

and H5N2 pintail from 2014/12/08:
GenBank Accession Numbers KP307973-KP307980 represent
sequences from the 8 segments of Influenza A virus
(A/Northern pintail/Washington/40964/2014(H5N2)).
segment 1segment 2segment 3segment 4segment 5segment 6segment 7segment 8

I'll probably post a mutation table and analysis later (1-2 days),
when they are more easily available through the genbank search-site

mutual differences in promille of the 3 available Asian H5 viruses:

Code:
  1 >A/Northern pintail/Washington/40964/2014,2014/12/08,USA,H5N2,Avian   
  1:  0,  0,  0,  0,  0,  0,  0,  0   A/Northern pintail/Washington/40964/2014,2014/12/08,USA,H5N2,Avian 
  2:  0,119,  2,  2,111,684,  1,  0   A/gyrfalcon/Washington/41088-6/2014,2014/12/08,USA,H5N8,Avian 
  3:  0,  1,  0,  1,  0,  3,  0,  2   A/turkey/BC/FAV10/2014,2014/12/02,Canada,H5N2,Avian 

  2 >A/gyrfalcon/Washington/41088-6/2014,2014/12/08,USA,H5N8,Avian
  1:  0,119,  2,  2,111,684,  1,  0   A/Northern pintail/Washington/40964/2014,2014/12/08,USA,H5N2,Avian 
  2:  0,  0,  0,  0,  0,  0,  0,  0   A/gyrfalcon/Washington/41088-6/2014,2014/12/08,USA,H5N8,Avian 
  3:  0,120,  3,  2,112,685,  1,  2   A/turkey/BC/FAV10/2014,2014/12/02,Canada,H5N2,Avian 

  3 >A/turkey/BC/FAV10/2014,2014/12/02,Canada,H5N2,Avian   
  1:  0,  1,  0,  1,  0,  3,  0,  2   A/Northern pintail/Washington/40964/2014,2014/12/08,USA,H5N2,Avian 
  2:  0,120,  3,  2,112,685,  1,  2   A/gyrfalcon/Washington/41088-6/2014,2014/12/08,USA,H5N8,Avian 
  3:  0,  0,  0,  0,  0,  0,  0,  0   A/turkey/BC/FAV10/2014,2014/12/02,Canada,H5N2,Avian

mutation table :
Code:
                                                                                    00000000000000111111111111111111111122 000000000000000000111111111111111111111222 0000000000000000000000000000111111111111111111111111111111122 00000000000000000000000000000000000000000001111111111111111111 0000000000000111111 000000000000000000000001111111 000000000000 00000000000 
                                                                                    13445567777789000223444555678888999900 001122344566788999000111223444456778899002 0111112244555666777888888899000001123334444555556666788999911 00000111122222223333344444445666677778888990000111134444555667 1123445568889023344 000111123445556678899990011112 122245556678 02223344567 
                                                                                    24497850458897034565028038411338125967 235701378059033589017279567044495587758365 5027785956268145228123578936005791163891249045783779649188913 23388118901234680124801666792333711790555162249015934788139780 1256452831298761547 229135700082563692200584504898 836822790295 01336812597 
                                                                                    62486875530615581400959771109794103840 433719079459514143871494734736993850236477 8894535762312254040987902496263460902944248627812185726136223 80148140526540759895948689482126845187038292312705700358650111 1089402576271201665 256489476665586915867554046807 974402980743 61497070218 
-codon-position---------------------------------------------------------------------        1           2 111   11                   1          2             1     1 1   1     1      1    1      1  1     21 11       1           1 1 1    1        2 2211 1   12   1   11   2       1    12  1          1    1    2 11       1   1  2   111     2     2   1  21  1 212   11 
---Index----------------------------------------------------------------------------CCCCACACGACGCTTACATGGAACCACGTATTCATCTG CAACCAAGGAGAGAATTGGTCCGAGAATACTCTGCCTGCTTA ATGTAAGAGGTGTGCTCCCTCGGGCGGTTTAACCTGCTTTTTCGTTTTAACACTTTGGGAT GGGAAAATCCCGTTGCCTCGCAAGATACGGATGACTAAGGGCGGAACCCCATTCACAGATTC ATGATAAAACTCGCTCACG GAAGTCACCTCGTGCAGGAAATAGGAACCT GCGAAAATACCT CGAAACTGGCT 
   1 >Index/h5n8b/Korea-2014,2014/01/01,Korea,H5N8,Avian,1                          ...................................... .......................................... ............................................................. .............................................................. ................... .............................. ............ ...........        0      0 ,      0      0       1:>Index/h5n8b/Korea-2014,2014/01/01,Korea,H5N8,Avian,1                          
   2 >Index/h5n8b2_2-21/Korea-2014,2014/01/01,Korea,H5N8,Avian,1                    T..................................... .......................................... ............................................................. .............................................................. ................... .............................. ............ ...........        1      1 ,      1      1       2:>Index/h5n8b2_2-21/Korea-2014,2014/01/01,Korea,H5N8,Avian,1                    
   3 >Index/h5n8b1_22-38/Korea-2014,2014/01/01,H5N8,Avian,1                         ......................C............... .......................................... ............................................................. ....................................GC......................C. .....G.....T....... .............................. ............ ...........        6      6 ,      6      6       3:>Index/h5n8b1_22-38/Korea-2014,2014/01/01,H5N8,Avian,1                         
   4 >A/baikal teal/Korea/Donglim3/2014,2014/01/17                                  ......................C............... .......................................... ............................................................. ....................................GC........T.............C. .....G.....T....... .............................. ............ ...........        8      7 ,      8      7       4:>A/baikal teal/Korea/Donglim3/2014,2014/01/17                                  
   5 >A/mallard/Korea/W452/2014,2014/02/05                                          ......................C............... .......................................... ...................................A......................... ....................................GC..A............A......C. ..A..G.....T....... .............................. ............ ...........       16     10 ,     16     10       5:>A/mallard/Korea/W452/2014,2014/02/05                                          
   6 >A/broiler Dk/Korea/Buan2/2014,2014/01/17                                      ...................................... .....G.................................... .......G.................A................................... .....................................C......................C. .....G.....T....... .............................. ............ ...........       11      7 ,     11      7       6:>A/broiler Dk/Korea/Buan2/2014,2014/01/17                                      
   7 >A/Ck/kumamoto/1-7/2014,2014/04/13                                             ...................................... .....................................A.... ....G............A.......A..........T........................ .............................................................. ................... .............................. ............ ...........       23      5 ,     23      5       7:>A/Ck/kumamoto/1-7/2014,2014/04/13                                             
   8 >A/turkey/BC/FAV10/2014,2014/12/02,Canada,H5N2,Avian,1                         T..T...TAG..TC..T..................ACA ------------------------------------------ ...C..........ACA....AT..A..............C.T...CC..T.......... ..A..G........A......G...........GA....A.......TTA....G..TG... ------------------- ------------------------------ ............ ...........      311    127 ,     41     36       8:>A/turkey/BC/FAV10/2014,2014/12/02,Canada,H5N2,Avian,1                         
   9 >KP307973,A/Northern pintail/Washington/40964/2014,2014/12/08,USA,H5N2,Avian   T..T...TAG..TC..T..................ACA ------------------------------------------ ...C..........ACA....AT..A..............C.T...CC..T.......... ..A..G........A.....AG...........GA....A.......TTA....G..TG... ------------------- ------------------------------ ............ ...........      308    128 ,     38     37       9:>KP307973,A/Northern pintail/Washington/40964/2014,2014/12/08,USA,H5N2,Avian   
  10 >KP307981,A/gyrfalcon/Washington/41088-6/2014,2014/12/08,USA,H5N8,Avian        T..T...TAG..T...T..................ACA .......A..A...............G............... ...C..........ACA....AT...................T...CC..T.......... ..A..G........A......G...........GA....A.......TT.....G..TG... ..AG........A...... .............................. ............ ...........       69     38 ,     69     38      10:>KP307981,A/gyrfalcon/Washington/41088-6/2014,2014/12/08,USA,H5N8,Avian        
  11 >h5n8pre1:k1203;1-15;1-15;628;628;k1203;1-15;1-15                              .TT.GTG...TT..GG.GCA...ATGT..GCGTGC... T.GT..G.AGAGAGG.CA.CTAACAC.CGTCT.A.TGATCC. GCA.GG.CAACAC.....T.T........CG.TT....CG.C..C...GG.GTC.CAA.GC C..GG.GATTTACC.ATCAAT.G.GCCTAACC...C..A.ATAAGGT...GCCT.TC..C.T GC..C.GGCTC..TCAGTA AG.A.TGTT.T.AATGAA.GGCGTAG.TTC .TAGG.G..TTC TAG.GACAATC      197    184 ,    197    184      11:>h5n8pre1:k1203;1-15;1-15;628;628;k1203;1-15;1-15                              
  12 >h5n8pre2:628;1111;1111;k1203;sd1;6d18;1111;1111                               .TT.GTG...TT..GG.GCAAG.ATGTACGCGTGC... TGGT..G.AGAGAGG.CA.CTAACAC.CGTCT.A.TGATCC. GCA.GG.CAACAC.....T.T........CG.TT....CG.C..C...GG.GTC.CAA.GC AAAGG.GATTTACC.AT.GAT.GAGCCTAACCA..C....AT.AG.T...GC.T.TC..C.T GC..C.GGCTC..TCAGTA AGGAGTGT.GTACATGA...G.GT.GGTTC .TAGG.G..TTC .AG.GACAATC      203    187 ,    203    187      12:>h5n8pre2:628;1111;1111;k1203;sd1;6d18;1111;1111                               
  13 >H5N8pre3:m234;1112;1112;m234;m234;goch1;628;1112                              .TT.GTG...TT..GG.GCAAG.ATGTACGCGTG.... TGGTT.G..GA.AGGGCAAC.AACACGCGTC.C.ATGATCCC GAA.GGA.A.CACAT..ATGT..AT.ACCCGGTTCATGCG...ACC..GG.GTCCCAAAGC C..GG.GATTTACC.ATCAAT.G.GCCTAACC...C..A.ATAAGGT...GCCT.TC..C.T GC..C.GGCTC..TCA.TA A.GAGTGT.GTACATGA.G.G.GT.GGTTC ATAGGGGGGTT. ...C.AC.ATC      274    204 ,    274    204      13:>H5N8pre3:m234;1112;1112;m234;m234;goch1;628;1112                              
  14 >H5N8pre4:wy11;008;108;wy19;wy11;90;008;1904                                   .TT.GTG...TT..GG.GCA.G.ATGT.CGCGTGC... T.GTTGGA.GA.AGGGCAAC.AATAC.CGTCTC.A.GATCCC GCA.GGA.AACACA...ATG...AT.ACCCGGTTC..GCG.C.ACC..GG.GTCCCAAAGC AA.GG.GATTTACC.AT.AAT.GAGCCTAACCA..C....ATAAG.T...GC.T.TC..C.T GC.G..GGCTC.ATCA.TA A..AC..TT...GATGAAGGGCGTAGGTTC ATAGGGGGGTT. T..C.A.AATC      400    201 ,    400    201      14:>H5N8pre4:wy11;008;108;wy19;wy11;90;008;1904                                   
                                                                                                                                                                                                                                                                                                                                                                               
---Index----------------------------------------------------------------------------CCCCACACGACGCTTACATGGAACCACGTATTCATCTG CAACCAAGGAGAGAATTGGTCCGAGAATACTCTGCCTGCTTA ATGTAAGAGGTGTGCTCCCTCGGGCGGTTTAACCTGCTTTTTCGTTTTAACACTTTGGGAT GGGAAAATCCCGTTGCCTCGCAAGATACGGATGACTAAGGGCGGAACCCCATTCACAGATTC ATGATAAAACTCGCTCACG GAAGTCACCTCGTGCAGGAAATAGGAACCT GCGAAAATACCT CGAAACTGGCT 
-codon-position---------------------------------------------------------------------        1           2 111   11                   1          2             1     1 1   1     1      1    1      1  1     21 11       1           1 1 1    1        2 2211 1   12   1   11   2       1    12  1          1    1    2 11       1   1  2   111     2     2   1  21  1 212   11 
                                                                                    00000000000000111111111111111111111122 000000000000000000111111111111111111111222 0000000000000000000000000000111111111111111111111111111111122 00000000000000000000000000000000000000000001111111111111111111 0000000000000111111 000000000000000000000001111111 000000000000 00000000000 
                                                                                    13445567777789000223444555678888999900 001122344566788999000111223444456778899002 0111112244555666777888888899000001123334444555556666788999911 00000111122222223333344444445666677778888990000111134444555667 1123445568889023344 000111123445556678899990011112 122245556678 02223344567 
                                                                                    24497850458897034565028038411338125967 235701378059033589017279567044495587758365 5027785956268145228123578936005791163891249045783779649188913 23388118901234680124801666792333711790555162249015934788139780 1256452831298761547 229135700082563692200584504898 836822790295 01336812597 
                                                                                    62486875530615581400959771109794103840 433719079459514143871494734736993850236477 8894535762312254040987902496263460902944248627812185726136223 80148140526540759895948689482126845187038292312705700358650111 1089402576271201665 256489476665586915867554046807 974402980743 61497070218

the gyrfalcon has 10+13+14+15+7+9+1+0=69 differences to the Korea sequences from January.
And it has only one such difference that goes towards candidate ancestor viruses,
you would expect more such differences, if the Korea sequences had time to evolve
since the common ancester.
So, this looks like it did descend from the Korean virus almost directly, despite the 69 differences.
Maybe the Korea virus lay in the water or came from
frozen meat without mutating for ~6 months .
This would be a rare observation, like the B.Mathews Turkey in 2007.

---------------------------------------------------------------------

on 2015/02/11 we had:
KM251533,Avian,1-8,H5N6,China,2014/04/27,A/chicken/Sichuan/NCJPL1/2014
KM251534,Avian,1-8,H5N6,China,2014/04/27,A/duck/Sichuan/NCJPL7/2014
KM251535,Avian,1-8,H5N6,China,2014/04/27,A/duck/Sichuan/NCXJ15/2014
KM251536,Avian,1-8,H5N6,China,2014/04/27,A/duck/Sichuan/NCXJ16/2014
KM251537,Avian,1-8,H5N6,China,2014/04/27,A/duck/Sichuan/NCXJ24/2014
KM251539,Avian,1-8,H5N1,China,2014/04/27,A/duck/Sichuan/NCXN10/2014
KM251540,Avian,1-8,H5N1,China,2014/04/27,A/duck/Sichuan/NCXN11/2014
KM251538,Environment,1-8,H5N6,China,2014/04/27,A/environment/Sichuan/NCLL1/2014
KM251541,Avian,1-8,H5N1,China,2014/04/27,A/pigeon/Sichuan/NCXN29/2014

------------------

just only one google hit for "A/gyrfalcon/Washington/41088-6/2014*
Noone cares.
__________________
a chart says more than 1000 words

Last edited by gsgs; 02-14-2015 at 09:00 AM.
gsgs is offline   Reply With Quote
Old 02-25-2015, 01:29 AM   #13
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
9 full genomes of Asian H5-viruses in America are available at genbank now.
They form 3 groups:
3 times original H5N8 (Korea,Jan.2014)
5 times H5N2 , segments 2,5,6 from American wild birds (by reassortment
during double-infection)
1 time H5N1 , segments 2,3,6,8 from American wild birds

viruses in each group are similar to each other (common anchester
less than 6 months ago in the genome, no further reassortments)

The Asian segments suggest one American introduction,
one American H5N8 index virus with 10,13,10,12,6,7,0,0
differences from the Korean H5N8-index virus.
8,-,7,9,-,6,0,0 of these mutations are also in the Taiwanese
viruses , so there is a common origin in summer of fall 2014.
It's still unclear which species brought it to America and on what route.
The common anchester with the European H5N8 is probably before
the Jan.2014 Korean outbreak in late 2013 or early Jan.2014,
so there is no connection.

the complete mutation table is here:
http://magictour.free.fr/h5n8nei4.l5
(only the Asian segments, rooted at the Korean-Jan.2014-index)


There are some unusual variations in the mutation rate.
The reassorted viruses show ~50% more mutations
in the Asian segments.
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 03-12-2015, 03:28 AM   #14
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
>600 H7N9 and related reassorted genomes from China were uploaded
to genbank on 2015/03/10

if there is interest, I can upload the mutation pictures

here the differences from the bird-index
http://magictour.free.fr/UPD79C.GIF
you can see how new fresh segments are acquired occasionally


the bird index has the almost static amino-acid inner segments (1,2,3,5,7,8)
of the mallard-flu reservoir.
Nucleotides do still mutate away in mallards in inner segments but they
encode the same amino-acid. OTOH In mallard's outer segments and in
poultry- and mammal-flu the amino-acids also accumulate mutations
over time.

see here for more details:
https://flutrackers.com/forum/forum/...nly-restricted ]


================================================== =

German article about H7N9, new study Yi Guan et.al. what Journal ? link ?
http://www.morgenpost.de/printarchiv...ppe-Virus.html

H7N9 best candidate for a pandemic

in English:
http://www.washingtonpost.com/news/t...searchers-say/

"should be considered as a major candidate to emerge as a pandemic strain in humans,"
researchers reported Wednesday.

"should" means :

http://www.nature.com/nature/journal...ture14348.html

article costs $32 = 30.2 euro

http://www.ncbi.nlm.nih.gov/nuccore/KJ195791
http://www.ncbi.nlm.nih.gov/nuccore/KP416238

[ historically pandemic segments usually came from previously rare viruses ]
__________________
a chart says more than 1000 words

Last edited by gsgs; 03-12-2015 at 04:26 AM.
gsgs is offline   Reply With Quote
Old 04-02-2015, 10:47 AM   #15
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
Asian H9N2 in Alaska
http://www.sciencedirect.com/science...42682215001646
KP336376–KP336391
http://www.ncbi.nlm.nih.gov/nuccore/KP336376
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 04-03-2015, 06:45 AM   #16
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
today seasonal humanm flu sequences from India, segments 4-8

[I think India is a major source, where new strains, new mutations emerge
in spring+summer which then come to Europe and also to East-Asia,Australia,
USA (sometimes)]


ftp://ftp.ncbi.nih.gov/genomes/INFLU...fluenza_na.dat
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 05-09-2015, 12:47 AM   #17
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
7 HAs from Lesser Noddies in Reunion (French Island , Indian Ocean)
A/Anous tenuirostris/Reunion/104C/2013(H2)
closest match is from gulls in Georgia(republic), 2012

zero google hits for "A/Anous tenuirostris/Reunion/311C/2013(H2)"

Code:
   0    0 1013    1 >A/Anous tenuirostris/Reunion/311C/2013(H2)
   0    0 1013    2 >A/Anous tenuirostris/Reunion/304C/2013(H2)
   0    0 1013    3 >A/Anous tenuirostris/Reunion/120C/2013(H2)
   0    0 1013    5 >A/Anous tenuirostris/Reunion/104C/2013(H2)
   9    1 1013    4 >A/Anous tenuirostris/Reunion/118C/2013(H2)
   9    1 1013    6 >A/Anous tenuirostris/Reunion/204C/2013(H2)
 138   14 1013  408 >CY185697,A/black-headed gull/Republic of Georgia/8/2012,2012/01/02,Georgia,H2N7,Avian,4
 157   16 1013  406 >CY185649,A/black-headed gull/Republic of Georgia/7/2012,2012/01/23,Georgia,H2N7,Avian,4
 167   17 1013  405 >CY185617,A/black-headed gull/Republic of Georgia/9/2012,2012/02/22,Georgia,H2N5,Avian,4
 287   25  870   17 >AB743879,A/gadwall/Mongolia/OIE-191/2012,2012/05/11,Mongolia,H2N9,Avian,4
 297   30 1007  464 >KC190167,A/northern shoveler/Republic of Georgia/1/2010,2010/01/29,Georgia,H2N3,Avian,4
 306   31 1013  280 >CY121983,A/northern shoveler/Georgia/1/2010,2010//,Georgia,H2N3,Avian,4
 315   32 1013  404 >CY185340,A/tufted duck/Republic of Georgia/1/2012,2012/12/22,Georgia,H2N3,Avian,4
 355   36 1013  407 >CY185681,A/mallard/Republic of Georgia/2/2012,2012/01/29,Georgia,H2N3,Avian,4
 473   48 1013  273 >CY121927,A/mallard/Sweden/58112/2006,2006/11/02,Sweden,H2N2,Avian,4
 483   49 1013  274 >CY121935,A/mallard/Sweden/58451/2006,2006/11/05,Sweden,H2N2,Avian,4
 493   50 1013  104 >CY041226,A/mallard/Netherlands/31/2006,2006//,Netherlands,H2N2,Avian,4
 493   50 1013  278 >CY121967,A/mallard/Netherlands/31/2006,2006//,Netherlands,H2N2,Avian,4
difference in 1/100 percent
nucleotide differences
nucleotides available
number in my list
virus-name,
isolation date,
country,
serotype,
species-group,
segment number


http://www.ncbi.nlm.nih.gov/nuccore/KJ184837
Influenza A virus on oceanic islands: host and viral diversity in
seabirds in the Western Indian Ocean
JOURNAL PLoS Pathog. (2015) In press
REMARK Publication Status: Available-Online prior to print
__________________
a chart says more than 1000 words

Last edited by gsgs; 05-09-2015 at 02:09 AM.
gsgs is offline   Reply With Quote
Old 05-16-2015, 11:41 AM   #18
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
there were _lots_ of flu-viruses at genbank in the last 2 days , thousands,
but it seems that most of these were old viruses that were already at genbank.
Then some few changes were made, like adding some data (date,lab,growth history,...)
and the virus is listed again. We had that before.
Genbank won't tell us ... at least I can't easily find it or figure it out.

-------------------------------------
number of total (nucleotide) flu-sequences listet at genbank on 2015/05/16
(already integrated into the database, which usually may take some days)
all=372145
flu-A=343100,flu-B=27786,flu-C=990
Human=187782,Avian=128017,Swine=40699
-------------------------------------
My last complete download is from 2015/03/13 with 366729 flu-sequences,
186092 of these human, 126762 avian , 39138 swine
337926+220 flu-A , 27294+2 flu-B , 616+267 flu-C , 404 unspecified,
1 apparently not flu at all, or reversed or such,
1 too long, apparently 2 segments concatenated
afair all of the unspecified were flu-A when I checked
~~0.5% of these have errors, missing or added nucleotides,
wrong recombinations , wrong collection dates etc.
---------------------------------------
__________________
a chart says more than 1000 words

Last edited by gsgs; 05-16-2015 at 11:59 AM.
gsgs is offline   Reply With Quote
Old 06-18-2015, 07:40 AM   #19
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
it's now one month that genbank had no flu-updates.
I hope they will be resumed and it was just holidays or such.
The due 2-monthly update for the whole genbank statistics (not just flu)
is also being delayed by 1-2 weeks.

---------------edit-----------------
resumed now !

13413 sequences on 2015/06/23
0 sequences on 2015/06/24
6 sequences on 2015/06/25
8 sequences on 2015/06/26
0 sequences between 2015/06/27 and 2015/07/01
-----------------update-----------------
2015/07/02,42 sequences (China,H3N2, 2012-2014
2015/07/03,343 sequences , China H3N2, Iowa H5N2-2015, Swine
2015/07/04,0 sequences
2015/07/05,312 sequences, flu-B
2015/07/06,0 sequences
2015/07/07,759 sequences
2015/07/08, 0 sequences
2015/07/09, 0 sequences
2015/07/10,1179 sequences,
lots of H1N1 from England, March 2010, which surprises me,
since I thought there was no flu-A in Europe or North America in 2009/10
after the fall-2009-wave ?!
checking flunet: http://www.who.int/influenza/gisrs_l...net/charts/en/
there were a few H1N1 in week 11/2010
2015/07/11, 0 sequences
2015/07/12, 8 sequences
-----------------------------------



8 H5N2 from USA
1 H5N8 from Netherlands
6 H5N2 from Taiwan

Code:
>KR137677,Avian,3,H5N2,Taiwan,2015/01/26,2151,A/chicken/CH/a556/2015(H5N2),,,,c
>KR137661,Avian,3,H5N2,Taiwan,2015/01/22,2151,A/chicken/GY/a451/2015(H5N2),,,,c
>KR234029,Avian,3,H5N2,USA,2015/03/12,2182,A/chicken/Kansas/8395-3/2015(H5N2),,,,c
>KR233997,Avian,3,H5N2,USA,2015/02/11,2182,A/chicken/Oregon/A01819044/2015(H5N2),,,,c
>KR137653,Avian,3,H5N2,Taiwan,2015/01/15,2151,A/chicken/PT/a158/2015(H5N2),,,,c
>KR137693,Avian,3,H5N2,Taiwan,2015/01/29,2151,A/chicken/SC/a688/2015(H5N2),,,,c
>KR137669,Avian,3,H5N2,Taiwan,2015/01/23,2151,A/chicken/TC/a504/2015(H5N2),,,,c
>KR137685,Avian,3,H5N2,Taiwan,2015/01/29,2151,A/chicken/TY/a665/2015(H5N2),,,,c
>KR233989,Avian,3,H5N2,USA,2015/01/29,2151,A/chicken/Washington/3490-18/2015(H5N2),,,,c
>KR232363,Avian,3,H5N8,Netherlands,2015/02/25,2134,A/eurasian wigeon/Netherlands/1/2015(H5N8),,,,p
>KR234021,Avian,3,H5N2,USA,2015/03/08,2182,A/turkey/Arkansas/7791-1/2015(H5N2),,,,c
>KR234005,Avian,3,H5N2,USA,2015/02/27,2182,A/turkey/Minnesota/7172-1/2015(H5N2),,,,c
>KR234037,Avian,3,H5N2,USA,2015/03/25,2182,A/turkey/Minnesota/9845-4/2015(H5N2),,,,c
>KR233981,Avian,3,H5N2,USA,2015/03/26,2182,A/turkey/Minnesota/9892-2/2015(H5N2),,,,c
>KR234013,Avian,3,H5N2,USA,2015/03/06,2182,A/turkey/Missouri/7458-1/2015(H5N2),,,,c
__________________
a chart says more than 1000 words

Last edited by gsgs; 07-12-2015 at 08:24 AM.
gsgs is offline   Reply With Quote
Old 08-04-2015, 08:22 AM   #20
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
A/mallard/Netherlands

lots of those today at genbank. Segments 4 (HA) and 6 (NA)
from ~2010 and neighboring years (I haven't looked at it yet, who did ?)
__________________
a chart says more than 1000 words
gsgs is offline   Reply With Quote
Old 08-07-2015, 09:39 AM   #21
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
euroswine since 2009 [paper : http://jvi.asm.org/content/early/201...40-15.abstract ]
USA,human, season 2013/4 segments 4,6,7
Singapore, H1N1, 2009-2010
Netherlands, wigeons, 2005
__________________
a chart says more than 1000 words

Last edited by gsgs; 08-07-2015 at 10:15 AM.
gsgs is offline   Reply With Quote
Old 09-09-2015, 12:17 PM   #22
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
no update since 2015/08/26
ftp://ftp.ncbi.nih.gov/genomes/INFLUENZA/updates/

my last complete download (influenza only) is from
2015/08/28 with 391216 sequences, 619MB fasta-format

129907 avian, 200768 human , 44805 swine , 7464 equine

32,Bat ; 1,Beetle; 3,Blow fly; 21,Bovine
15,Camel; 1639,Canine; 91,Cat; 11,Cheetah
17,Civet; 4414,Environment; 25,Feline; 86,Ferret
4,Giant anteater; 15,Leopard; 62,Mink; 20,Muskrat
8,Panda; 32,Penguin; 48,Pika; 16,Raccoon dog
1194,Reassortant; 103,Seal; 8,Sloth bear; 8,Stone marten
66,Tiger; 271,Unknown; 13,Whale; 21,Wild boar


segments: 36211,36131,36058,98156,36542,61172,48152,38794

359065 flu-A
30756 flu-B
990 flu-C
83E,12I,28S,17s,265u

26651 H5N1, 5469 H5N2, 1568 H5N8, 6375 H7N9, 16537 H9N2
17160 H3N8, 9200 H4N6 ... , 1 H13N4
__________________
a chart says more than 1000 words

Last edited by gsgs; 09-09-2015 at 12:46 PM.
gsgs is offline   Reply With Quote
The Following User Says Thank You to gsgs For This Useful Post:
andy (02-25-2017)
Old 10-25-2015, 11:32 AM   #23
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
13 early H3N2-genomes from USA from the 2014/15 season
came yesterday at genbank

( they should have some from this season already ?! )



nucleotides:

Code:
                                                                    000000000000000000000000000000000000011111111111111111111111111111111222222222 000000000000000000000000000011111111111111111111111111122222 0000000000000000000000000000000111111111111111111111111111111111111111111111111111111111122222 00000000000000000000000000000000000000000000000000000011111111111111111 0000000000000000000000000000111111111111 00000000000000000000000000000000000000111111111111111 000000000000000000000000000 000000000000000000000000000000000 
                                                                    000111112223444455556666777778888888800011333344455555566666778889999000111112 001333334455666666678888899900001112223445555667778899900012 0011122222233334444567888889999000011112222222233333333333333333444444555556677778889999900000 00011122222222334444444444555555666666677777888899999901222344444555556 0001111223334555566668888899011111223334 00000011222223344444555566777888888999000001111122223 122233334444555566677788889 000001111112222223333455566777788 
                                                                    133888880372027804690137447791123477903544348918923577823358691680125479015792 244134570113023333441347968938993441462010558071565901755680 3713801134646790589146011362369445712392677899900111223345556788367889034586603581792245800123 12513912234678121234567778224579023457922469778901448800699201389112473 2595667890683112612344467855412667132484 25678935000788945789015556368004689889012883557856773 666712230224114401368947881 017791145561256890178214501123801 
                                                                    906123674745504346447998475726997108782606246898176415492500312612409697987806 257898428791373469440146707382257398869139477849714084728012 3572694910120898605366135712024129165111125403628147692873692169740567615770574584866976025357 89548632870735889001002392470991056240316758035465281454006370751384223 4193237249615695157690643517868479536869 51664661124023976265192813437043888673333098585949285 317354702061030905902324693 980692474699061220520624237895757 
-codon-position-----------------------------------------------------1  12  1  11        11    1    1 1 2                2       2                  1              1  2   1      2                  2        2        21             11  2  1 21 1       1                           1  1   1     2       11     21  1         12 1  1122222 1   1   1 1                         1    1      1              1       1        1   1  1  11 1   2   1        2112  1 12  12   1  21      1                  12121111   11 1  1 1 11  1   2 21  21  111 
---Index------------------------------------------------------------CGGAAAGGGTTGTGGTTAGTGTATAACAGAACTTCGAGGGATGTATGTCGACCGAGGTTCTAAAGTGGTCGGAAGCCT CATACGGATAAGAGAGGTGTAACTTGAGCGCGGCAATGCCGTCGGCAAGAGCAGCGAAAG GGCGGCTGAGCGTAATGCGTGCATAGTACATCAGTAAGAAGGCTGCAAGCTAAGTCGCTTAAGATGAGCTATATCACAACTAGCTGGAGGGTCG TTCCGGTCTCCCGTATGCATAGAGAGTAGAGGCTTACAGACTGTTCTCACCCACATGGTGGACACGGGCGG GATTGCCGGAAGTCTGGTTGAGAGCAACATGAGAAGAGAT ATCACTCATCGGTACAGCGTTACAAAGCGCGTGACACCATCGAACTTACTGGG CTCTGGCTGTGGTATCGTGCACTCAAA CGGATCATCAGTGGGTTAAGAGTAACGAGGGGT 
   1 >A/Czech-manipulated64493231,2012/06/06,Czech Republic         .............................................................................. ............................................................ .............................................................................................. ....................................................................... ........................................ ..................................................... ........................... .................................        0      0 ,      0      0       1:>A/Czech-manipulated64493231,2012/06/06,Czech Republic         
   2 >A/Czech Republic/121/2012,2012/03/06,Czech Republic           .........................G...........A.........C.................G...T.......C .G.........A...............................A......T......... ...................................................C.................C..........C.....A....... .....A..C....C..A........A...G..........T.........................AA... .............T....G....A................ T.................................A.................. ...CA...................G.. ...G.............................       32     32 ,     32     32       2:>A/Czech Republic/121/2012,2012/03/06,Czech Republic           
   3 >Index/32g12f1.c2,10-37                                        ........T............C............A.......A.......G.......................A... .............................A.............................. ..T...C.....C..........C................A..................................................... ..........T...............................A......A................A.... ......T.....C............TG............. ............................................T.....A.. ........................... ..............A......A...........       24     24 ,     24     24       3:>Index/32g12f1.c2,10-37                                        
   4 >Index/32g12f1.c2_10-37_mod6,2012//,H3N2,USA                   ........T............C............A.......A.......G........................... .............................A.............................. ..T...C.....C..........C...................................................................... ..........T...............................A......A..................... ......T.....C............TG............. ..................................................... ........................... ..............A......A...........       19     19 ,     19     19       4:>Index/32g12f1.c2_10-37_mod6,2012//,H3N2,USA                   
   5 >Index/kkk,0-15669                                             .A........................................A............................A...T.. ..C........................A...........T.............A...... ....A..............C............................A.................................A......A..G. ..A.....................G.A...........AG............T...A.......AA..... ................A..........T...........C .........T..........C....T........................... T......C................... .................................       31     31 ,     31     31       5:>Index/kkk,0-15669                                             
   6 >Index/USA/2014f/1,2014/06/06,USA,H3N2,Human                   .A.....A.........G....G......G........T...A..........A......C..........A...T.. ..C.....C....A.............A...........T.....TG......A...... ....A..............C....GA......................A......................C.CT.......A.....AA..G. ..A.A...................G.AC..........AG............T...A.....A.AA..... ....A...........A....A.TT..T...........C .........T..........C....T...A............GG......... T......C................... ....C......................G..A..       61     61 ,     61     61       6:>Index/USA/2014f/1,2014/06/06,USA,H3N2,Human                   
   7 >KT837158,A/New Mexico/27/2014(H3N2),2014/09/18,USA,H3N2       .A.....A.........G....G......G........T...A..........A......C.......C..A...T.. ..C.....C....A.....C.......A...A.......T.....TG......A....G. ....A...........A..C....GA...G..................A......................CCCT.T.....A.....AA..G. ..A.A............A......G.A...........AG............T...A.....A.AA..... ....A...........A....A.TT..T...........C .........T..........C....C...A............GG......... T......C................... ....C......................G..A..       69     69 ,     69     69       7:>KT837158,A/New Mexico/27/2014(H3N2),2014/09/18,USA,H3N2       
   8 >KT837240,A/Minnesota/21/2014(H3N2),2014/09/17,USA,H3N2        .A.....A.........G....G......G...C....T...A..C.......A......C...A......A...T.. ..C.....C....A.............A...........T.....TG....A.A...... ....A..............C....GA........A......A....G.A......................C.CT.T.....A.....AA..G. C.A.A...................G.AC.........GAG............T...A.....A.AA..... ....A...........A....A.TT..TG..........C .C.......T..........C...GT...A...........AGG......... T......C.............A..... ....C...................GT.G..A..       78     78 ,     78     78       8:>KT837240,A/Minnesota/21/2014(H3N2),2014/09/17,USA,H3N2        
   9 >KT837226,A/Pennsylvania/40/2014(H3N2),2014/09/13,USA,H3N2     .AS....A...A.....G..A.G......G...C....T...A..C.......A......C.G........A...T.. ..C.....C....A.............A....T......T.....TGT...A.A...... ....A..............C....GA........A.....AATAATTGATC.G.CTA.CCG.AGC......C.CT.......A.....AA..G. C.A.A...................G.AC..........AG............T...A.....A.AA..... ....A...........A....A.TT..TG..........C .C.......T..........C...GT...A...........AGG........A T......C................... ....C...................G..G..A..       98     98 ,     98     98       9:>KT837226,A/Pennsylvania/40/2014(H3N2),2014/09/13,USA,H3N2     
  10 >KT837318,A/Minnesota/22/2014(H3N2),2014/09/20,USA,H3N2        .A..RR.A...A..A.CG....G.G....G........T...A..........A......C..........A...T.. ..C.....C....A.A...........A...........T.....TG......A...... ....A.........G....C....GA......................A......................C.CT.......A.....AA..G. ..A.A...................G.AC..........AG............T...A....GA.AA..... ....A...........A....A.TT..T...........C .........T......AT..C....TA..A.C..........GG......... T......C................... ....C.GA...................GT.A..       77     77 ,     77     77      10:>KT837318,A/Minnesota/22/2014(H3N2),2014/09/20,USA,H3N2        
  11 >KT838357,A/Louisiana/14/2014(H3N2),2014/10/22,USA,H3N2        .A.....A.......C.G....GC.....G........C...A..........A......CG.........A...T.. ..C.....C...TA...........A.A..........TT.....TG......A...... ....A..............C...AGA.......A..............A......................C.CT.......A.....AA.CG. ..A.A.C.................G.AC....T.....AG....A.......T...A.....A.AA....A ....AA.A........A....A.TT..T...........C .........T.....G....C....T...A............GG......... T.T....C..A...........C..G. ....C.............G.......TG..A..       83     83 ,     83     83      11:>KT838357,A/Louisiana/14/2014(H3N2),2014/10/22,USA,H3N2        
  12 >KT838348,A/Louisiana/08/2014(H3N2),2014/10/11,USA,H3N2        TA.....A.........G.C..GC.....G........T...A.....T....A......CG.........A...T.. ..C....GC....A.............A.......G..TT.....TG......A...... .A..AT.A...........C....GA..........G...........A............G.........C.CT.......A.....AA..G. ..A.A......T............G.AC..........AG.....T.....TT...A.....A.AA..... ....A...A.......A....A.TT..T...........C .........T..........C....T...A..A.........GG......... T......C.C..C.............. ..T.C............G.........G..A..       83     83 ,     83     83      12:>KT838348,A/Louisiana/08/2014(H3N2),2014/10/11,USA,H3N2        
  13 >KT838324,A/Connecticut/21/2014(H3N2),2014/10/14,USA,H3N2      .A.....A.........G....G......G......G.T...A..........A......C..........A...T.. T.CG..A.C....A..T..........A........C..T.....TG.....GA...... ....A..............C....GA......................A...................A..C.CT.......AT.A..AA..G. ..A.A..................AG.AC........A.AG............T...A.....A.AA..... ....A.....GT....A....A.TT..T...C.......C ......T..TA.......A.C....T.T.A............GG......... TC.....C..........A.......G T...C......................G..A..       84     84 ,     84     84      13:>KT838324,A/Connecticut/21/2014(H3N2),2014/10/14,USA,H3N2      
  14 >KT838331,A/New Hampshire/21/2014(H3N2),2014/10/17,USA,H3N2    .A.......C....................CT........G.A........T....ACCT...........A.TAT.. ..C..A...........C.....CC.GA.....T.....T.............A..G... ...CA.....AA...C.T.C...............G............A................A................A......A..G. .CA......T.....C........G.AC..........AG.C.....TG...T...A......GAA..TA. .........G...................AA..G.....C ....T....TA.........C.T..T.......G.CA.........C...... T....A.CA.................. .A......TGTAA..C.......G.....A..C       87     87 ,     87     87      14:>KT838331,A/New Hampshire/21/2014(H3N2),2014/10/17,USA,H3N2    
  15 >KT837320,A/Florida/35/2014(H3N2),2014/09/23,USA,H3N2          ......A..C..................A...G.........AC.......T...A.C.T...........A...T.. ..C.AA...G...........G.CC.GA.....T......A............A.A.... .........A...........A....CG...T.......G.............A.....................G.CGT.G..C.....A..A ...............C..G.GTG...A.A.A..CA....G.............T.C..A..G....A.... AGC............AA...G.G....T....A....... ..T.T....T...G......CG...T.......G............CTA..A. ...C.............A.T....... ...................T.............       81     81 ,     81     81      15:>KT837320,A/Florida/35/2014(H3N2),2014/09/23,USA,H3N2          
  16 >KT838351,A/Connecticut/19/2014(H3N2),2014/10/03,USA,H3N2      ...R........C.............T.....Y..A.....C..G....A................A.....G...TC ..................A.G.T.....T.TA.....A....T.A..............A .............T....A.A..........TC....AG...........................GA..G.....T....G.....G...... ...T........A.G...G...G........A...G.......C.............AAAA.......... ...C.......A..C..C.S.................... ...G...GC.......A........C...........A.C.....C....... .............CCTA...G..T... .....A..............G............       68     68 ,     68     68      16:>KT838351,A/Connecticut/19/2014(H3N2),2014/10/03,USA,H3N2      
  17 >KT838319,A/Florida/45/2014(H3N2),2014/10/12,USA,H3N2          ..........Y.CA....A........T...........A.C..........A.G...........AA..T.G..... ..........G...G...A...T.......TA..G......CT.A...AG.A..A..T.A ........G....T....A...G.....T..T.....A................................G.....T..........G.....A ...T...T......G...G...G........A...G.......C..A...T...G...A.A.......... ...C.......A......................G.G... .....C.G...A..T........G.C....A.......G.T....C...C... ......T......C............. .....A..........A.....C..........       73     73 ,     73     73      17:>KT838319,A/Florida/45/2014(H3N2),2014/10/12,USA,H3N2          
  18 >KT838352,A/North Carolina/21/2014(H3N2),2014/10/06,USA,H3N2   ............C..............T.............C....A................T..A.....G..... ..........G.......A...T.....T.TA..G.......T.A...AG....A..T.A A............T....A...G.......GT.....A...................T............G................G...... ...T..........G...GC..G........A...G.......C..A...........A.A.......... ...C.......A..................A....A.AC. .......G....C......C.....C..A................C....... ...........A.C............. .....A.......A..A.....C........A.       61     61 ,     61     61      18:>KT838352,A/North Carolina/21/2014(H3N2),2014/10/06,USA,H3N2   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
---Index------------------------------------------------------------CGGAAAGGGTTGTGGTTAGTGTATAACAGAACTTCGAGGGATGTATGTCGACCGAGGTTCTAAAGTGGTCGGAAGCCT CATACGGATAAGAGAGGTGTAACTTGAGCGCGGCAATGCCGTCGGCAAGAGCAGCGAAAG GGCGGCTGAGCGTAATGCGTGCATAGTACATCAGTAAGAAGGCTGCAAGCTAAGTCGCTTAAGATGAGCTATATCACAACTAGCTGGAGGGTCG TTCCGGTCTCCCGTATGCATAGAGAGTAGAGGCTTACAGACTGTTCTCACCCACATGGTGGACACGGGCGG GATTGCCGGAAGTCTGGTTGAGAGCAACATGAGAAGAGAT ATCACTCATCGGTACAGCGTTACAAAGCGCGTGACACCATCGAACTTACTGGG CTCTGGCTGTGGTATCGTGCACTCAAA CGGATCATCAGTGGGTTAAGAGTAACGAGGGGT 
-codon-position-----------------------------------------------------1  12  1  11        11    1    1 1 2                2       2                  1              1  2   1      2                  2        2        21             11  2  1 21 1       1                           1  1   1     2       11     21  1         12 1  1122222 1   1   1 1                         1    1      1              1       1        1   1  1  11 1   2   1        2112  1 12  12   1  21      1                  12121111   11 1  1 1 11  1   2 21  21  111 
                                                                    000000000000000000000000000000000000011111111111111111111111111111111222222222 000000000000000000000000000011111111111111111111111111122222 0000000000000000000000000000000111111111111111111111111111111111111111111111111111111111122222 00000000000000000000000000000000000000000000000000000011111111111111111 0000000000000000000000000000111111111111 00000000000000000000000000000000000000111111111111111 000000000000000000000000000 000000000000000000000000000000000 
                                                                    000111112223444455556666777778888888800011333344455555566666778889999000111112 001333334455666666678888899900001112223445555667778899900012 0011122222233334444567888889999000011112222222233333333333333333444444555556677778889999900000 00011122222222334444444444555555666666677777888899999901222344444555556 0001111223334555566668888899011111223334 00000011222223344444555566777888888999000001111122223 122233334444555566677788889 000001111112222223333455566777788 
                                                                    133888880372027804690137447791123477903544348918923577823358691680125479015792 244134570113023333441347968938993441462010558071565901755680 3713801134646790589146011362369445712392677899900111223345556788367889034586603581792245800123 12513912234678121234567778224579023457922469778901448800699201389112473 2595667890683112612344467855412667132484 25678935000788945789015556368004689889012883557856773 666712230224114401368947881 017791145561256890178214501123801 
                                                                    906123674745504346447998475726997108782606246898176415492500312612409697987806 257898428791373469440146707382257398869139477849714084728012 3572694910120898605366135712024129165111125403628147692873692169740567615770574584866976025357 89548632870735889001002392470991056240316758035465281454006370751384223 4193237249615695157690643517868479536869 51664661124023976265192813437043888673333098585949285 317354702061030905902324693 980692474699061220520624237895757

amino acids:

Code:
                                                             00000000 00000000 00000000000000000 00000000000000000000 000000 000000000000000000 0000 000000000000000000 
                                                             01224557 22335667 01222333344566667 00011111111112223555 123344 000012222233333334 2233 000000111122222333 
                                                             60097286 11678185 72157023402506671 11614455667780242046 215759 024522466923338997 5805 225789227803578115 
                                                             39333480 25196878 06662812871458957 09600448015679417557 770209 966181537091580270 3551 467468471261850793 
                                                             -------- -------- ----------------- -------------------- ------ ------------------ ---- ------------------ 
                                                             VVVRMTI VRRKREQ AEDQNIYSIIVIKVVN ILEYSTARNSFKNFRNQDV ESTDG TIPMKESVTVNSSLIII IY DKADALMNIISDSVRR 
>A/Czech-manipulated64493231,2012/06/06,Czech Republic       .......} .......} ................} ...................} .....} .................} }..} ...........}.....} 
>A/Czech Republic/121/2012,2012/03/06,Czech Republic         .......} .....D.} ................} ..K.N....N..D......} .....} S................} }..} .E.........}.....} 
>Index/32g12f1.c2,10-37                                      .......} ..K....} ..........I.....} ...................} .....} .................} }..} ...........}.....} 
>Index/32g12f1.c2_10-37_mod6,2012//,H3N2,USA                 .......} ..K....} ................} ...................} .....} .................} }..} ...........}.....} 
>Index/kkk,0-15669                                           .......} .......} .............I.K} .I......S.Y....DHN.} .....} .....D...........} }..} ...........}.....} 
>Index/USA/2014f/1,2014/06/06,USA,H3N2,Human                 I.....T} .......} ....S........I.K} .I......S.YT...DHN.} .....} .....D..K.....V..} }..} ...........}.....} 
>KT837158,A/New Mexico/27/2014(H3N2),2014/09/18,USA,H3N2     I.....T} .......} ....S.C......I.K} .I..R...S.Y....DHN.} .....} .....D..K.....V..} }..} ...........}.....} 
>KT837240,A/Minnesota/21/2014(H3N2),2014/09/17,USA,H3N2      I.....T} .......} ....S........I.K} .I......S.YT..GDHN.} ..A..} .....D..K.....V..} }..} ...........}GL...} 
>KT837226,A/Pennsylvania/40/2014(H3N2),2014/09/13,USA,H3N2   III...T} ...N...} ....S.....I..I.K} .I......S.YT...DHN.} ..A..} .....D..K.....V..} }..} ...........}G....} 
>KT837318,A/Minnesota/22/2014(H3N2),2014/09/20,USA,H3N2      II....T} M......} ....S........I.K} .I......S.YT...DHN.} .....} .....DN.K.....V..} }..} ...........}...I.} 
>KT838357,A/Louisiana/14/2014(H3N2),2014/10/22,USA,H3N2      I.....T} .......} ....S........I.K} .I......S.YT...DHNI} .....} .....D..K.....V..} }.H} ..........I}..L..} 
>KT838348,A/Louisiana/08/2014(H3N2),2014/10/11,USA,H3N2      I.....T} .......} V...S........I.K} .I......S.YT...DHN.} .....} .....D..KI....V..} }..} Y..........}.....} 
>KT838324,A/Connecticut/21/2014(H3N2),2014/10/14,USA,H3N2    I.....T} .......} ....S........I.K} .I.....KS.YT...DHN.} D....} ..S..D..K.....V..} }..} ...........}.....} 
>KT838331,A/New Hampshire/21/2014(H3N2),2014/10/17,USA,H3N2  .......} .......} .............I.K} TI.H....S.YT...DHN.} ...E.} .....D....T....T.} }..} ..SN.....V.}....K} 
>KT837320,A/Florida/35/2014(H3N2),2014/09/23,USA,H3N2        .......} .......} ...K.V...M.VR.I.} ...H.ASG..Y..L.D...} .G...} ....RD.........TL} }..} ......I....}.....} 
>KT838351,A/Connecticut/19/2014(H3N2),2014/10/03,USA,H3N2    ...K...} .K.....} .DN.....L...R...} .....A.G...........} .....} .V.V.D.....R.S...} }V.} .......S...}.....} 
>KT838319,A/Florida/45/2014(H3N2),2014/10/12,USA,H3N2        .....N.} .K..K.L} .D..............} .....A.G...........} .....} ...V.D......G....} }..} .....M..T..}.....} 
>KT838352,A/North Carolina/21/2014(H3N2),2014/10/06,USA,H3N2 ....I..} .K..K.L} .D.....A........} .....A.G...........} ....S} ...V.D.I.........} }..} ....TM..T..}.....}


https://en.wikipedia.org/wiki/Influe...5_f lu_season

the vaccine 2014/15 was : A/Texas/50/2012 (H3N2)-like virus , clade 3C.1
but most strains were instead A/Switzerland/9715293/2013-like , clade 3C.3a

clade 3C.2a
clade 3C.3x,L157S,N122D,
clade 3C.3

http://magictour.free.fr/ag14f.PNG
(add 14? to the WHO-amino-acid-positions to get mine)


update 2015/10/28 : 14 new genomes today,
the most recent is from Alaska, June,2015
updated mutation table:

Code:
                                                                    000000000000000000000000011111111111111111111111112222222 000000000000000000000000111111111111111111111111111111111222222 00000000000000000000000000001111111111111111111111111111111111112222 000000000000000000000000000000000000000011111111111111 0000000000000000000000000000000000011111111111111 00000000000000000000000000001111111111 00000000000000 0000000000000000000 
                                                                    001122233344455666788888900011333455556666677888990111122 001113344556667888888999000001122333444555666667778888899011222 01122223334455566788888899990011111222233344455555555666678888990000 000011122222333444445555556666667777889900012224444555 0000001111111223444566777888888899900111223333344 00001222333444556666788888880011112223 12223344556778 0011112223333445577 
                                                                    138900312802749137712347503624359913572233869558199015712 124783400172349013479489358994446238001588027884560036917636024 71801142674913433601136622494736789267902744703358899668950017580023 155613413469129136771224691346692269881828800690139113 2456991566677298344645259224667825504256690347748 56885003029257002568304689998835771579 66792302161664 1911481690157221518 
                                                                    907914765750464998769710482226268186450925031171427987816 987499858937445461467573812253930926173417864096713663047039204 57644901084531306613571412831114281112389404061374769057550348602557 845248082071886200298470418623831658585157843067071383 4510094323847841578191600560143571788827395885792 16481240319762157137403881780988562426 37354020315031 8924736120542692287 
-codon-position-----------------------------------------------------1 11   11      1    1 1                    2              11          12    1      12    1                2        2          1            1  2    1      2   1      1  1      1 1    2   11     12  221    1 11112222       2 1       212        1            1        1 1   1 1         1       11       111 2   1 1 1    22 1   1  1 2    1 1  1       111   1     1      2 11 
---Index------------------------------------------------------------CGGGTGTAGCTGGATTATAACTTCAGGAATGATCCACGCGGTCTAGCGGGGAAGCAT CTTTGCGGTAAGGGGAGACTTCAGCCGCGCACACAACCGCAGCAAGAAGACGGGCGCATGGCC GCGATGGGTATGTCATCCATAGTGGAATCTGCAAAAGGCGGCTCAATGTACTAACTGCCAAGAGGGCG TACGCGAAGCCTATCAAGAATTAGAGCTATAGACGTTACAAGTTCGTGACCGGA GTAGGTATGCGGCTGGTGAGATTCCCCGTGCATACTAGGGAGAGGCGTA TCCAACGTTGCGGCTCGAAAGCTGACTCGAATTACCGC CCTCGTGTAGTCGC GTCATAAGTAAAGGCTAAG 
   1 >A/Czech-manipulated64493231,2012/06/06,Czech Republic         ......................................................... ............................................................... .................................................................... ...................................................... ................................................. ...................................... .............. ...................        0      0 ,      0      0       1:>A/Czech-manipulated64493231,2012/06/06,Czech Republic         
   2 >A/Czech Republic/121/2012,2012/03/06,Czech Republic           .........................A..............................C ............................................................... .................................................................... .................................T..................A. .............................A................... ...........................A.......... ..C........... ...................       32      7 ,     32      7       2:>A/Czech Republic/121/2012,2012/03/06,Czech Republic           
   3 >Index/32g12f1.c2,10-37                                        .....T.........C.......A......A....G.................A... ..........................A.................................... .T..C...C..........C................A............................... .........T........................A...A.............A. ............T...C..............T.G............... ....................................A. .............. .......A.....A.....       24     23 ,     24     23       3:>Index/32g12f1.c2,10-37                                        
   4 >Index/32g12f1.c2_10-37_mod6,2012//,H3N2,USA                   .....T.........C.......A......A....G..................... ..........................A.................................... .T..C...C..........C................................................ .........T........................A...A............... ............T...C..............T.G............... ...................................... .............. .......A.....A.....       19     19 ,     19     19       4:>Index/32g12f1.c2_10-37_mod6,2012//,H3N2,USA                   
   5 >Index/kkk,0-15669                                             .A............................A...................A...T.. ..C....................A............T..................A....... ..A.........C..........................A.....................A..A.G. ..A................G.A.........AG......T.....A....AA.. ...................A..............T............C. .....T........C...T................... T....C........ ...................       31     31 ,     31     31       5:>Index/kkk,0-15669                                             
   6 >Index/USA/2014f/1,2014/06/06,USA,H3N2,Human                   .AA..........G..G..G......T...A......A.....C......A...T.. ..C.....C..A...........A............T.....T.G..........A....... ..A.........C.......GA.................A......C.C.T..........A.AA.G. ..A..A.............G.AC........AG......T.....A...AAA.. ........A..........A.......A.TT...T............C. .....T........C...T..A.......GG....... T....C........ .C...............GA       61     61 ,     61     61       6:>Index/USA/2014f/1,2014/06/06,USA,H3N2,Human                   
   7 >KT837158,A/New Mexico/27/2014(H3N2),2014/09/18,USA,H3N2       .AA..........G..G..G......T...A......A.....C......A...T.. ..C.....C..A...........A....A.......T.....T.G..........A....... ..A.........C.......GA.................A......C.C.T...T......A.AA.G. ..A..A.............G.A.........AG......T.....A...AAA.. ........A..........A.......A.TT...T............C. .....T........C...C..A.......GG....... T....C........ .C...............GA       69     62 ,     69     62       7:>KT837158,A/New Mexico/27/2014(H3N2),2014/09/18,USA,H3N2       
   8 >KT837240,A/Minnesota/21/2014(H3N2),2014/09/17,USA,H3N2        .AA..........G..G..G..C...T...A.C....A.....C...A..A...T.. ..C.....C..A...........A............T.....T.G.........AA....... ..A.........C.......GA.......A.......A.A......C.C.T...T......A.AA.G. C.A..A.............G.AC........AG......T.....A...AAA.. ........A..........A.......A.TT...T.G..........C. C....T........C..GT..A......AGG....... T....C........ .C..............GGA       78     74 ,     78     74       8:>KT837240,A/Minnesota/21/2014(H3N2),2014/09/17,USA,H3N2        
   9 >KT837226,A/Pennsylvania/40/2014(H3N2),2014/09/13,USA,H3N2     .AA.....A....G..G..G..C...T...A.C....A.....C......A...T.. ..C.....C..A...........A............T.....T.G.........AA....... ..A.........C.......GA.......A......AATA......C.C.T..........A.AA.G. C.A..A.............G.AC........AG......T.....A...AAA.. ........A..........A.......A.TT...T.G..........C. C....T........C..GT..A......AGG....... T....C........ .C..............GGA       98     75 ,     98     75       9:>KT837226,A/Pennsylvania/40/2014(H3N2),2014/09/13,USA,H3N2     
  10 >KT837318,A/Minnesota/22/2014(H3N2),2014/09/20,USA,H3N2        .AA.....A...AG..G..G......T...A......A.....C......A...T.. ..C.....C..AA..........A............T.....T.G..........A....... ..A.........C.......GA.................A......C.C.T..........A.AA.G. ..A..A.............G.AC........AG......T.....A..GAAA.. ........A..........A.......A.TT...T............C. .....T......ATC...T.AAC......GG....... T....C........ .C.GA............GA       77     71 ,     77     71      10:>KT837318,A/Minnesota/22/2014(H3N2),2014/09/20,USA,H3N2        
  11 >KT838357,A/Louisiana/14/2014(H3N2),2014/10/22,USA,H3N2        .AA..........G..GC.G......C...A......A.....CG.....A...T.. ..C.....C..A...........A.........T..T.....T.G..........A....... ..A.........C......AGA.................A......C.C.T..........A.AA.G. ..A..A.............G.AC........AG......T.....A...AAA.. ........AA.........A.......A.TT...T............C. .....T........C...T..A.......GG....... TT...C........ .C........G......GA       83     68 ,     83     68      11:>KT838357,A/Louisiana/14/2014(H3N2),2014/10/22,USA,H3N2        
  12 >KT838348,A/Louisiana/08/2014(H3N2),2014/10/11,USA,H3N2        TAA..........GC.GC.G......T...A..T...A.....CG.....A...T.. ..C.....C..A...........A.........T..T.....T.G..........A....... A.A..A......C.......GA.................A......C.C.T..........A.AA.G. ..A..A....T........G.AC........AG......T.....A...AAA.. ........A.....A....A.......A.TT...T............C. .....T........C...T..A.A.....GG....... T....C.C...... .C.......G.......GA       83     74 ,     83     74      12:>KT838348,A/Louisiana/08/2014(H3N2),2014/10/11,USA,H3N2        
  13 >KT838324,A/Connecticut/21/2014(H3N2),2014/10/14,USA,H3N2      .AA..........G..G..G......T...A......A.....C......A...T.. ..C.....C..A...........A............T.....T.G..........A....... ..A.........C.......GA.................A......C.C.T..........A.AA.G. ..A..A.............G.AC........AG......T.....A...AAA.. ........A......T...A.......A.TT...T............C. .....TA.......C...T..A.......GG....... T....C........ .C...............GA       84     63 ,     84     63      13:>KT838324,A/Connecticut/21/2014(H3N2),2014/10/14,USA,H3N2      
  14 >KT838309,A/Wyoming/08/2014(H3N2),2014/10/09,USA,H3N2          .AA.....A...AG..G..G......T...A......A.....C......A...T.. ..C.....C..AA..........A............T.....T.G..........A....... ..A.........C.......GA.................A......C.C.T..........A.AA.G. ..A..A.............G.AC........AG......T.....A...AAA.. ........A..........A.......A.TT...T............C. .....T......ATC...T.AAC......GG....... T....C......T. .C.GA............GA       76     71 ,     76     71      14:>KT838309,A/Wyoming/08/2014(H3N2),2014/10/09,USA,H3N2          
  15 >KT838330,A/Texas/37/2014(H3N2),2014/10/01,USA,H3N2            .AA.....A...AG..G..G......T...A......A.....C......A...T.. ..C.....C..AA..........A............T.....T.G..........A....... ..A.........C.......GA.................A......C.C.T..........A.AA.G. ..A..A.............G.AC........AG......T.....A...AAA.. ........A..........A.......A.TT...T............C. .....T......ATC...T.AAC......GG....... T....C........ .C.GA............GA       76     70 ,     76     70      15:>KT838330,A/Texas/37/2014(H3N2),2014/10/01,USA,H3N2            
  16 >KT838289,A/Louisiana/12/2014(H3N2),2014/10/21,USA,H3N2        TAA..........GC.GC.G......T...A..T...A.....CG.....A...T.. ..C.....C..A...........A.........T..T.....T.G..........A....... A.A..A......C.......GA.................A......C.C.T..........A.AA.G. ..A..A....T........G.AC........AG......T.....A...AAA.. ........A..........A.......A.TT...T............C. .....T........C...T..A.A.....GG....... T....C.C...... .C.......G.......GA       76     73 ,     76     73      16:>KT838289,A/Louisiana/12/2014(H3N2),2014/10/21,USA,H3N2        
  17 >KT838307,A/Mississippi/05/2014(H3N2),2014/10/14,USA,H3N2      .AA..........G..GC.G......T.G.A......A.....CG.....A...T.. ..C.....C..A...........A.........T..T.....T.G.....T....A...A... ..A.........CA......GA.....C....G......A......C.C.T..........A.AA.G. ..A..A.G...........G.AC.G......AG....G.T.....A...AAA.. .A......AA.......ACA.......A.TT...T............C. .....T.....A..C...T..A.......GG....... TT.T.C........ .C...............GA       85     80 ,     85     80      17:>KT838307,A/Mississippi/05/2014(H3N2),2014/10/14,USA,H3N2      
  18 >KT838183,A/Mississippi/08/2014(H3N2),2014/10/23,USA,H3N2      .AA..........G..GC.G......T.G.A......A.....CG.....A...T.. ..C.....C..A...........A.........T..T.....T.G.....T....A...A... ..A.........CA......GA.....C....G......A......C.C.T..........A.AA.G. ..A..A.G...........G.AC.G......AG....G.T.....A...AAA.. .A......AA.......ACA.......A.TT...T............C. .....T.....A..C...T..A.......GG....... TT.T.C........ .C...............GA       84     80 ,     84     80      18:>KT838183,A/Mississippi/08/2014(H3N2),2014/10/23,USA,H3N2      
  19 >KT838280,A/Colorado/15/2014(H3N2),2014/10/04,USA,H3N2         .AA..........G..G..G..C...T...A.C....A.....C...A..A...T.. ..C.....C..A...........A............T.....T.G.........AA....... ..A.........C.......GA.......A.......A.A......C.C.T..........A.AA.G. C.A..A.............G.AC........AG......T.....A...AAA.. ........A..........A.......A.TT...T.G..........C. C....T........C..GT..A......AGG....... T....C........ .C........G.....GGA       77     74 ,     77     74      19:>KT838280,A/Colorado/15/2014(H3N2),2014/10/04,USA,H3N2         
  20 >KT844077,A/Alaska/14/2015(H3N2),2015/06/03,USA,H3N2           .AA..........G..G..G......T...A......A.....C.....AA...T.. ..C.....C..A...........A....A.......T.....T.G..........A....... ..A.........C.......GA.................A......C.C.T..........A.AA.G. ..A..A.............G.AC........AG......T.....A...AAA.. ........A..A.......A.......A.TT...T............C. .....T........C...T.AA...A...GG....... T....C........ .C...............GA       89     66 ,     89     66      20:>KT844077,A/Alaska/14/2015(H3N2),2015/06/03,USA,H3N2           
  21 >KT838331,A/New Hampshire/21/2014(H3N2),2014/10/17,USA,H3N2    .A....C.............T.........A.....T...ACT.......A.TAT.. ..C...A............CC.GA.....T......T..................A....... ..A.........C..........................A.....................A..A.G. ..A..........C.....G.AC........AG......T.....A....AA.. .....................................A.........C. ..T..TA.......C...T.....G.......C..... T...ACA....... A..................       87     52 ,     87     52      21:>KT838331,A/New Hampshire/21/2014(H3N2),2014/10/17,USA,H3N2    
  22 >KT837320,A/Florida/35/2014(H3N2),2014/09/23,USA,H3N2          ......C..............G........A.....T..A.CT.......A...T.. ..C..AA..........G.CC.GA.....T........A................A....... ......A..........A....C..G..T......G....A............G...T..G....A.A .............C..GTG..A.A...A....G..........C..A.G...A. A.G..C.............AG.............T....A......... .TT..T........C...T.....G.......C..A.. ..C.......AT.. ............T......       81     63 ,     81     63      22:>KT837320,A/Florida/35/2014(H3N2),2014/09/23,USA,H3N2          
  23 >KT838351,A/Connecticut/19/2014(H3N2),2014/10/03,USA,H3N2      ..........C..........Y.......C..................A..G....C .............A....T.....T..TA..........T.A..................A.. .........T.A................T.A...G.........GG........T.....G.G..... ....T.......G...G.G......A..G......C..........AA...... .......C.......A................................. ....G.......A.....C............C...... ........C..... ..A................       68     41 ,     68     41      23:>KT838351,A/Connecticut/19/2014(H3N2),2014/10/03,USA,H3N2      
  24 >KT838319,A/Florida/45/2014(H3N2),2014/10/12,USA,H3N2          ..........CA......T..........C..................A..G..... .........G...A....T........TA.G........T.A......AG....A.AT..A.. .........T.A......G.........T.A..............G........T.......G....A ....T.......G...G.G......A..G......CA.........AA...... .......C.......A................................. ....G.....T.......C............C...... ........C..... ..A.....A......C...       73     49 ,     73     49      24:>KT838319,A/Florida/45/2014(H3N2),2014/10/12,USA,H3N2          
  25 >KT838352,A/North Carolina/21/2014(H3N2),2014/10/06,USA,H3N2   ..........C.......T..........C..................A..G..... .........G...A....T.....T..TA.G........T.A......AG......AT..A.. .........T.A......G.........T.A..............G................G..... ....T.......G...G.G......A..G......CA.........AA...... .......C.......A.....................A......A.... ....G.............C............C...... ........C..... ..A.....A......C...       61     47 ,     61     47      25:>KT838352,A/North Carolina/21/2014(H3N2),2014/10/06,USA,H3N2   
  26 >KT838305,A/Mississippi/04/2014(H3N2),2014/10/16,USA,H3N2      ......C.A............G........A...T.T..A.CT.......A...T.. ..C..AA..........G.CC.GA.....T.T....T.........G....A...A..C.... ......A..........A....C..G..T......G....A............G...TT.G....A.A ...........C....GTG..C.A..TA..G.GTA.....G..CA.A.....A. A..A.C.............AG..T.T........T....A......... .TT..TA.......CT..TG....GA......C..A.. ..........AT.. T....G.....GT......       84     83 ,     84     83      26:>KT838305,A/Mississippi/04/2014(H3N2),2014/10/16,USA,H3N2      
  27 >KT838316,A/Mississippi/03/2014(H3N2),2014/10/15,USA,H3N2      ......C.A............G........A...T.T..A.CT.......A...T.. ..C..AA..........G.CC.GA.....T.T....T.........G....A...A..C.... ......AT.........A....C..G..T......G....A............G...TT.G....A.A ...........C....GTG..C.A..TA..G.GTA.....G..CA.A.....A. A..A.C.............AG..T.T........T....A......... .TT..TA.......CT..TG....GA......C..A.. ..........AT.. T....G.....GT......       84     84 ,     84     84      27:>KT838316,A/Mississippi/03/2014(H3N2),2014/10/15,USA,H3N2      
  28 >KT838101,A/Maine/04/2014(H3N2),2014/10/09,USA,H3N2            ......CG............T.........A.....T...ACT.......A.TAT.. .............A....T.....T..TA..........T.A..................A.. .........T.A................T.A.............GG........T.......G..... ....T.......G...G.G......A..G......C..........AA...... .......C.......A................................. ....G.............C............C...... T...ACA....... ..A................       71     47 ,     71     47      28:>KT838101,A/Maine/04/2014(H3N2),2014/10/09,USA,H3N2            
  29 >KT838239,A/Florida/39/2014(H3N2),2014/10/07,USA,H3N2          ...AC....A..............G..G..AG......T......AT...A...TG. TC.CA..A..G...AGA....T.T.T......G.CG.TA.G..G.A.G....AA.......TT ...G..AA..C...GCT......AA.G....T.C....TA.TCT...A.T.GG..CA..G........ .G.A..G.A.....TGG.G.C........C...........AA...A.....AT ..G.A.G...AA.CA......CG.T.T.C..GC..A..A.CAGAAAA.G ...G.T.CCAT...C.A.T.......C......GT.AT T....C...A..TT ......G.......A.C..      125    123 ,    125    123      29:>KT838239,A/Florida/39/2014(H3N2),2014/10/07,USA,H3N2          
  30 >KT838106,A/Florida/40/2014(H3N2),2014/10/07,USA,H3N2          ...AC....A..............G..G..AG......T......AT...A...TG. TC.CA..A..G...AGA....T.T.T......G.CG.TA.G..G.A.G....AA.......TT ...G..AA..C...GCT......AA.G....T.C....TA.TCT...A.T.GG..CA..G........ .G.A..G.A.....TGG.G.C........C...........AA...A.....AT ..G.A.G...AA.CA......CG.T.T.C..GC..A..A.CAGAAAA.G ...G.T.CCAT...C.A.T.......C......GT.AT T....C...A..TT ......G.......A.C..      123    123 ,    123    123      30:>KT838106,A/Florida/40/2014(H3N2),2014/10/07,USA,H3N2          
  31 >KT838322,A/Florida/37/2014(H3N2),2014/10/07,USA,H3N2          ...AC....A..............G..G..AG......T......AT...A...TG. TC.CA..A..G...AGA....T.T.T......G.CG.TA.G..G.A.G....AA.......TT ...G..AA..C...GCT......AA.G....T.C....TA.TCT...A.T.GG..CA..G........ .G.A..G.A.....TGG.G.C........C...........AA...A.....AT ..G.A.G...AA.CA......CG.T.T.C..GC..A..A.CAGAAAA.G ...G.T.CCAT...C.A.T.......C......GT.AT T....C...A..TT ......G.......A.C..      125    123 ,    125    123      31:>KT838322,A/Florida/37/2014(H3N2),2014/10/07,USA,H3N2          
  32 >KT838315,A/Florida/38/2014(H3N2),2014/10/07,USA,H3N2          .......G...A.............A.......................A......C TC.CA..A.......GA....T.T.T......G.C..TA....G...G.....A.......TT ...G..AA..C...GCT......AC........CG........T...A.T.GG..C...G........ ................G.G.C....................A....A.....A. ..G.A.G...AA.CA......CG.T.T.C.T.C.TA..A.C..A.AA.G .............T.............A.......... .............. ................C.A      144     74 ,    144     74      32:>KT838315,A/Florida/38/2014(H3N2),2014/10/07,USA,H3N2          
                                                                                                                                                                                                                                                                                                                                                                                                                                                      
---Index------------------------------------------------------------CGGGTGTAGCTGGATTATAACTTCAGGAATGATCCACGCGGTCTAGCGGGGAAGCAT CTTTGCGGTAAGGGGAGACTTCAGCCGCGCACACAACCGCAGCAAGAAGACGGGCGCATGGCC GCGATGGGTATGTCATCCATAGTGGAATCTGCAAAAGGCGGCTCAATGTACTAACTGCCAAGAGGGCG TACGCGAAGCCTATCAAGAATTAGAGCTATAGACGTTACAAGTTCGTGACCGGA GTAGGTATGCGGCTGGTGAGATTCCCCGTGCATACTAGGGAGAGGCGTA TCCAACGTTGCGGCTCGAAAGCTGACTCGAATTACCGC CCTCGTGTAGTCGC GTCATAAGTAAAGGCTAAG 
-codon-position-----------------------------------------------------1 11   11      1    1 1                    2              11          12    1      12    1                2        2          1            1  2    1      2   1      1  1      1 1    2   11     12  221    1 11112222       2 1       212        1            1        1 1   1 1         1       11       111 2   1 1 1    22 1   1  1 2    1 1  1       111   1     1      2 11 
                                                                    000000000000000000000000011111111111111111111111112222222 000000000000000000000000111111111111111111111111111111111222222 00000000000000000000000000001111111111111111111111111111111111112222 000000000000000000000000000000000000000011111111111111 0000000000000000000000000000000000011111111111111 00000000000000000000000000001111111111 00000000000000 0000000000000000000 
                                                                    001122233344455666788888900011333455556666677888990111122 001113344556667888888999000001122333444555666667778888899011222 01122223334455566788888899990011111222233344455555555666678888990000 000011122222333444445555556666667777889900012224444555 0000001111111223444566777888888899900111223333344 00001222333444556666788888880011112223 12223344556778 0011112223333445577 
                                                                    138900312802749137712347503624359913572233869558199015712 124783400172349013479489358994446238001588027884560036917636024 71801142674913433601136622494736789267902744703358899668950017580023 155613413469129136771224691346692269881828800690139113 2456991566677298344645259224667825504256690347748 56885003029257002568304689998835771579 66792302161664 1911481690157221518 
                                                                    907914765750464998769710482226268186450925031171427987816 987499858937445461467573812253930926173417864096713663047039204 57644901084531306613571412831114281112389404061374769057550348602557 845248082071886200298470418623831658585157843067071383 4510094323847841578191600560143571788827395885792 16481240319762157137403881780988562426 37354020315031 8924736120542692287
__________________
a chart says more than 1000 words

Last edited by gsgs; 10-28-2015 at 04:38 AM.
gsgs is offline   Reply With Quote
Old 11-20-2015, 07:47 AM   #24
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
genbank influenza (nucleotide sequences) downloaded again on 2015/11/20
657MB as a fasta file access-code,name,date,country,subtype,host,segment

408150 sequences after 391216 on 2015/08/28
131107 avian ones after 129907 on 2015/08/28
214526 human ones after 200768 on 2015/08/28
46545 swine ones after 44805 on 2015/08/28

131107=15094+15089+15038+22145+14694+17855+15812+1 5380
46545=3856+3838+3900+12063+4061+7713+7027+4087


no interesting new (closing gaps between important strains
i_brevig,i_sweu,i_mexflu,i_eq,i_tripl0)
avian viruses found so far

the origin of Mexflu is still a mystery, no prepandemic matching
swine viruses between 1998 and 2009 except probably
A/Sw/4/Mexico/2009/04/,

--------edit------------- well, looking closer,
A/Swine/South Dakota/A01267895/2012/10/19(H1N1) looks suspicious
in segment 3 as having evolved from a mexflu-precursor



http://www.fludb.org/brc/fluSegmentD...ator=influenza

[I can no longer find the whole genbank entry for a sequence, so I used fludb here]

with a link to :
http://www.uniprot.org/uniprot/M9QRZ1

USDA Swine Surveillance
Submitted (MAR-2013) to the EMBL/GenBank/DDBJ databases
Cited for: NUCLEOTIDE SEQUENCE.

Submitted (13-MAR-2013) USDA, Ames, IA 50010, USA


there are some indications of a "dirty chromatogram" like thing,
as we saw it before. So I challenge them to sequence this again,
as it is the most interesting sequence wrt. the origin of mexflu
that I found.

http://magictour.free.fr/switsg3d.GIF

------------------------------
LOCUS KC779027 2280 bp cRNA linear VRL 08-APR-2013
DEFINITION Influenza A virus (A/swine/South Dakota/A01267895/2012(H1N1))



JOURNAL Submitted (26-NOV-2012) National Veterinary Services Laboratories,
USDA, 1920 Dayton Ave, Ames, IA 50010, USA
COMMENT ##Assembly-Data-START##
Sequencing Technology :: Sanger dideoxy sequencing
/note="passage details: P2"


ACCESSION KC779030 segment 4
ACCESSION KC209521 segment 7
ACCESSION KC209522 segment 6



CONSRTM USDA Swine Surveillance
TITLE Direct Submission
JOURNAL Submitted (13-MAR-2013) USDA, Ames, IA 50010, USA
COMMENT ##Assembly-Data-START##
Assembly Method :: Sequencher v. 5.0
Sequencing Technology :: IonTorrent
/isolation_source="lung"


ACCESSION KC779028 segment 1
ACCESSION KC779029 segment 2
ACCESSION KC209520 segment 3
ACCESSION KC779031 segment 8

-----------------------------------------------------

## I convinced myself in the meantime that SD/A01267895 PA is a multi-pseudo-recombination -
## probably erraneous. Presumably created by incorrectly joining the partial chunks
## in a run with several flu-sequences simultaneously ("next generation" ?)
## As already seen with Walter Reed Institute before

so, no new evidence for the mexflu-origin


here the mutations of the 11 segment-3 submitted on 12-MAR-2013 by
the Ames-lab together with the 2 relevant indices :
Code:
                                                                  00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000011111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111222222222 
                                                                  00000011111111111111222222222222222222223333333333333344444445555555555566666666666777777777777777888888888888888888999999999999900000000000000001111111111112222222222233333333333344444444444445555555555555666666667777777778888888888889999999999999000000001 
                                                                  57899900223456677888001111112455555678890223344456779923457990112344568911233356789001122456667888000112223466678999002345666788900012233566688991134566678880013355789901123355568900011234689990012333467899011455681134568990134566677890123567888999023346774 
                                                                  15206925032702801139140134692402345702519170325826280308167281695139615418408973573591429191267589146592490717832147037927037538325670358907835280610214701580750614214981462816980845709870780673627136868439247839270640812476232136978762118021369258761734068 
-codon-position---------------------------------------------------  1            2 1     1 1   11 12              1                   1   2   2       1  2   2 1 22   22  2121  1             1 21   1      12  2           2   1       1       1      1        22     1           1   1                 2     1           1        
---Index----------------------------------------------------------GACCTCACACCGTCAGGAAATAATACGGCACAACCAGCCCTGGTTGCAAGGGCCCCTAGTGCACTCACGAGAGAACGGTGCTCAGAGGGTGGCAAACACCGAGTCTCTTACTCTGGAGAATGTCAAAACCCCGGGCGGAAGGGCGCGGCCTTTTACTCCCATGCAGGCACCGCTCTCTGTTTGCTCCCTGAATTGTTTGACTCTAGAAGCGGACCGCATGCCGCGCCACAAAAGTGCCCCAGAGAAGTTCAACACGA 
   1 >xxxxxxxx,A/Sw/Index/triple-reassortant/1998,1998//,H3N2     .................................................................................................................................................................................................................................................................        0      0 ,      0      0       1:>xxxxxxxx,A/Sw/Index/triple-reassortant/1998,1998//,H3N2     
   2 >xxxxxxxx,A/Mexflu/index/2009,2009/02/01,H1N1                .G....GT.TT.........CG.C.T.......T...ATA.T.....G.A.AT.T.C..C...T.T..A.A.AG.TA.C......G...C.A...G.G......TCAC..T..C..GA..C...G...T..A...A...G......AA...AC..T.......T.A...T....TC....C...C..T....C.......T.A.....AT....................GGG......T................G       72     72 ,     72     72       2:>xxxxxxxx,A/Mexflu/index/2009,2009/02/01,H1N1                
   3 >KC779019,A/Sw/Missouri/A01203163/2012,2012/01/17,H1N1       .G...TGT.TT.........C..C.T.......T...ATA.T.....G.A.AT.T.C..C...T.T..A.A.AG.TA.CA.C..AG...C.A...G.G......TCAC..TC.C..GA..C..AG..GT..A...A...G......AA.T.AC..T......AT.A...T.A..TC....C...C..T....C.......T.A...G.AT.......G............GGG.....TT...A...........AG       86     86 ,     86     86       3:>KC779019,A/Sw/Missouri/A01203163/2012,2012/01/17,H1N1       
   4 >KC779009,A/Sw/Iowa/A01203125/2012,2012/01/06,H1N2           .G....GT.TT......G.GCG.C.TA......T...ATA.T.....G.A.AT.T.C..C...T.T..A.A.AG.TA.C......G...C.A...G.G......TCAC..T..C.AGA..C...G.G.T..A...A.A.G......AA...AC.GT.......TGA...T....TC....C...C..T....C..C....T.A....GATAA...............G..GGG....T.T......A.......A..       87     87 ,     87     87       4:>KC779009,A/Sw/Iowa/A01203125/2012,2012/01/06,H1N2           
   5 >KC779014,A/Sw/Wisconsin/A01203142/2012,2012/01/11,H1N1      .G....GT.TT......G.GCG.C.TA......T...ATA.T.....G.A.AT.T.C..C...T.T..A.A.AG.TA.C......G...C.A...G.G......TCAC..T..C.AGA..C...G.G.T..A...A.A.G......AA...AC.GT.......TGA...T....TC....C...C..T....C..C....T.A....GATAA...............G..GGG....T.T......A.......A..       87     87 ,     87     87       5:>KC779014,A/Sw/Wisconsin/A01203142/2012,2012/01/11,H1N1      
   6 >KC778994,A/Sw/Minnesota/A01202471/2011,2011/07/28,H1N2      .G....GT.TT......G..CG.C.TA......T...ATA.T.....G.A.AT.T.C..C...T.T..A.A.AG.TA.C......G...C.A...GTG......TCAC..T..C..GA..C...G.G.T..A...A...G......AA...AC..T.......TGA...T.A.CTC....C...C..T....C..C....T.A....GATA...................GGG....T.T................G       83     83 ,     83     83       6:>KC778994,A/Sw/Minnesota/A01202471/2011,2011/07/28,H1N2      
   7 >KC779039,A/Sw/California/A00968789/2013,2013/01/15,H1N1     AG....GT.TT......G..CG.C.TA......T...ATA.T.....G.A.AT.T.C......T.T..A.A.AGGTAAC......G..AC.A...GAG......TCAC.....C..GA..C...G.G.T..AA..A...GA.....AA...AC..T.......TGA..GTA...TC....C...C..T....C.....A.T.A...GGATA...........A.......GGGA.....T........C.......G       90     90 ,     90     90       7:>KC779039,A/Sw/California/A00968789/2013,2013/01/15,H1N1     
   8 >KC779029,A/Sw/South Dakota/A01267895/2012,2012/10/19,H1N1   AG....GT.TT......GC....CG.....AG...........CCAT.G.AAT.T.A......TCT..A.........C.............TC....T.....TCAC.....C..GAG..........TA........GA....T..T.C..........C............TC....C...C..T....C.......T.A...GGATA..........T..A......GG...T..T................G       66     66 ,     66     66       8:>KC779029,A/Sw/South Dakota/A01267895/2012,2012/10/19,H1N1   
   9 >KC778999,A/Sw/Indiana/A01202631/2011,2011/10/01,H1N2        .GT.C.G.G....T.A..C.....GA....AG..T.A.....ACCAT.G.A....T........C.G...........C.......A.....TC....T....CT.........A..AG......T...TA..A.........T.T..T.C..C...T..GC............T......CTT...T.AG..CC.CC...C..GA.....A......C.TT.......................G.C.T.GT....       69     69 ,     69     69       9:>KC778999,A/Sw/Indiana/A01202631/2011,2011/10/01,H1N2        
  10 >KC778989,A/Sw/Indiana/A00968380/2012,2012/07/18,H3N2        .GT.C.G.G...CT.A..C.....G.....AG..T.A...C.ACCAT.G.A....T...CA.G.C.G...........C.......A.....TC..A.T....C..........A..AG......T...TA..AA..........T..T.C..C...TA.GCA...........T......CCT...T.AG..CC.CC...C..G......A......C.TT............C....TG.G..G.C.T.GT...G       79     79 ,     79     79      10:>KC778989,A/Sw/Indiana/A00968380/2012,2012/07/18,H3N2        
  11 >KC779034,A/Sw/Michigan/A01203498/2012,2012/05/07,H3N2       ..TAC...G..A.T.AA.C...C.G.....AGG..GA.T...ACCA..G.A......G...T..A.G...........C....G..AAA.T.TC....T...A.....GG..T....AG..........TA.......G.....AT..T.C.CC...T...C..G.......T.T...T..CAT.....A....T.CC.G.C..........T.....CA.T.....................AG..C.TG.....G       76     76 ,     76     76      11:>KC779034,A/Sw/Michigan/A01203498/2012,2012/05/07,H3N2       
  12 >KC779004,A/Sw/Pennsylvania/A01201666/2011,2011/06/14,H3N2   ...T......AA.TG...CG.......ATC...A..A.....ACCATG..A.....C.T.A......A..AG.G..AAC.T.TG..A.......C...TAAG............AA.AGG.AC.....T.......A....A......T......TC..T.C....AA.....CT.TG.C...T...TCA......CC.G.C.C....A.A..T.A...A.T.A.TT.TG.....A.....A...G.......G..G       85     85 ,     85     85      12:>KC779004,A/Sw/Pennsylvania/A01201666/2011,2011/06/14,H3N2   
  13 >KC779024,A/Sw/Illinois/A01201770/2011,2011/06/19,H3N2       ...T......AA.TG...C........ATC.G....A.....ACCATG..A..T..C.T.A......A.GAG.G...AC.T.TG..A...T..CC...TAAG............AA.AGG.AC.....T.A.....A....AA.....T......TC..T.C....AA......T.TG.C...T.TTTCA.G....CC.G.C.CG...A....TA.A..A.T.A.TT.T......A...T.AG..G.......G..G       93     93 ,     93     93      13:>KC779024,A/Sw/Illinois/A01201770/2011,2011/06/19,H3N2       
                                                                                                                                                                                                                                                                                                                                    
---Index----------------------------------------------------------GACCTCACACCGTCAGGAAATAATACGGCACAACCAGCCCTGGTTGCAAGGGCCCCTAGTGCACTCACGAGAGAACGGTGCTCAGAGGGTGGCAAACACCGAGTCTCTTACTCTGGAGAATGTCAAAACCCCGGGCGGAAGGGCGCGGCCTTTTACTCCCATGCAGGCACCGCTCTCTGTTTGCTCCCTGAATTGTTTGACTCTAGAAGCGGACCGCATGCCGCGCCACAAAAGTGCCCCAGAGAAGTTCAACACGA 
-codon-position---------------------------------------------------  1            2 1     1 1   11 12              1                   1   2   2       1  2   2 1 22   22  2121  1             1 21   1      12  2           2   1       1       1      1        22     1           1   1                 2     1           1        
                                                                  00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000011111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111111222222222 
                                                                  00000011111111111111222222222222222222223333333333333344444445555555555566666666666777777777777777888888888888888888999999999999900000000000000001111111111112222222222233333333333344444444444445555555555555666666667777777778888888888889999999999999000000001 
                                                                  57899900223456677888001111112455555678890223344456779923457990112344568911233356789001122456667888000112223466678999002345666788900012233566688991134566678880013355789901123355568900011234689990012333467899011455681134568990134566677890123567888999023346774 
                                                                  15206925032702801139140134692402345702519170325826280308167281695139615418408973573591429191267589146592490717832147037927037538325670358907835280610214701580750614214981462816980845709870780673627136868439247839270640812476232136978762118021369258761734068
you see how A/SD/A01267895 is similar to the segments above or below,
depending on the location.
There is probably a name for this sort of error already ...

--------------------------------------------------------

although I can no longer get the genbank records directly through their URL,
(as done before and with the direct links in the forums)
I can still download them
in the old form from the ftp - site at ftp://ftp.ncbi.nih.gov/genbank/
That gave 1.5hours for the 38 vrl files to download and another 1.5hours to unzip them
yielding 8.66GB. Then another 0.5hours to extract the influenza-records from them,
giving 2.19GB , which I can search for keywords.

---------------------------------------------------------------------
__________________
a chart says more than 1000 words

Last edited by gsgs; 11-22-2015 at 06:11 AM.
gsgs is offline   Reply With Quote
Old 12-09-2015, 02:40 PM   #25
gsgs
searching for truth
 
gsgs's Avatar
 
Join Date: Sep 2008
Location: Germany
Posts: 3,739
Thanks: 3
Thanked 151 Times in 106 Posts
~900 poultry H9 - HAs from China yesterday

I normed it to the 2010 "East China H9 -index" which we examined
in 2013 as the origin of the inner segments of the H7N9 outbreak.

731 chicken , 104 pigeon , 10 quail

each line is one HA, each column is one nucleotide position in HA
each black pixel is a difference to the index

http://magictour.free.fr/ud09d5.GIF

~7 different strains, the top 2 presumably did not come from
that ~2010 index, but separated earlier.
The 3rd strain from Guangdong has quite some extra mutations
than the others

still 726 out of 810 H9-HAs in that list come from that 2010 East-China
poultry H9N2 index (evolution-bottleneck)

That H9N2 emerged in the early 1990s, after there was almost no
poultry-flu in China in the 1980s
__________________
a chart says more than 1000 words

Last edited by gsgs; 12-09-2015 at 03:17 PM.
gsgs is offline   Reply With Quote
Reply

Tags
fluviruses, genbank, interesting

Thread Tools Search this Thread
Search this Thread:

Advanced Search
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

Forum Jump


All times are GMT -4. The time now is 07:14 AM.


Powered by vBulletin®
Copyright © Jelsoft Enterprises Ltd.